Objectives: This study was designed to see if ischemic postconditioning could attenuate ischemic reperfusion injury of transplanted lungs recovered from non–heart-beating donors.
Materials and Methods: Forty Sprague-Dawley rats were randomized into 2 groups: the control group and the ischemic postconditioning group, with 10 donor rats paired with 10 recipient rats in each group. Twenty rats underwent a left lung transplant from non–heart-beating donors with a warm ischemia time of 36.7 ± 5.62 minutes. In the ischemic postconditioning group, 5 cycles of 1-minute reperfusion and 1-minute reocclusion at the onset of reperfusion were applied as postconditioning. Arterial blood gas, wet-to-dry lung weight ratio, activities of malondialdehyde and superoxide dismutase, and expressions of apoptosis and ICAM-1 mRNA were compared.
Results: When compared with the control group 4 hours after reperfusion, PaO2 was higher, and wet-to-dry lung weight ratio was lower, in the ischemic postconditioning group, and expression of apoptosis and ICAM-1 mRNA as well as activity of malondialdehyde were lower, while superoxide dismutase activity was higher in the ischemic postconditioning group.
Conclusions: Ischemic postconditioning can reduce ischemic reperfusion injury of lungs recovered from non–heart-beating donors and preserve lung function by reducing reactive oxygen species and inhibiting apoptosis and inflammation.
Key words : Ischemic postconditioning, Lung transplant, Non–heart-beating donors, Ischemic reperfusion injury, Lung protection
Introduction
The increasing gap between the number of individuals awaiting organ replacement surgery and the supply of organs available for transplant underpins attempts to increase the number of available organs. Recently, lung transplants from non–heart-beating donors have been seen as a promising alternative to increase the donor pool.1-3 However, ischemic reperfusion injury, as a continuing problem leading to early graft dysfunction in lung transplant4 deserves our concern.
Ischemic postconditioning (IPo), originally introduced by Zhao and coworkers,5 defined as brief cycles of reperfusion alternating with reocclusion applied immediately at the onset of reperfusion, can reduce irreversible postischemic injury. Recent studies6-9 have demonstrated that IPo can attenuate ischemic reperfusion injury of many organs (eg, heart, brain, and lung). Because the onset of reperfusion is predictable and under a clinician’s control, postconditioning is more clinically applicable than is preconditioning in unexpected acute ischemia.
This study, using a rat model of lung donation after cardiac death, was designed to investigate whether IPo can reduce ischemic reperfusion injury of lung grafts recovered from non–heart-beating donors, and how it works.
Materials and Methods
Animal model
The study was approved by the Animal Care Committee of Central-South University,
China, and was performed in accordance with National Institutes of Health
guidelines for the use of experimental animals (NIH publication No. 85-23,
revised 1996).
Forty Sprague-Dawley male rats weighing between 205 and 255 grams (provided by the Department of Laboratory Animals of Hunan Agricultural University) were randomized into 2 groups, with 10 donor rats paired with 10 recipient rats in each group. Donor rats were anesthetized with an intraperitoneal injection of 0.7 to 0.8 mL chloral hydrate and mechanically ventilated, with a tidal volume of 7 to 10 mL at a rate of 70 to 80 breaths/minute. Then, the abdominal aorta was cut open to lose blood. No donor rats were heparinized. Thirty minutes after cardiac arrest, the anterior wall was excised, and the trachea was clamped with the lungs fully inflated. An 18-gauge intravenous cannula was inserted into the main pulmonary artery and tightened, through which donor lungs were flushed with 4°C low-potassium dextran at a perfusion pressure of 20 cm H2O, and the left atrial auricle was cut open at the same time for drainage of the low-potassium dextran solution. After flush, the vascular and bronchial stumps of the donor lungs were prepared by the “two-cuff-one-stent technique,” first introduced by Zhang and coworkers,10 with which we anastomosed the pulmonary arteries and veins in a traditional cuff technique and anastomosed the bronchi in a self-made stent technique. Then, the donor lungs were removed and stored in 4°C low-potassium dextran for 1 hour. These maneuvers and the subsequent operation were performed with an operating microscope at ×10 magnification.
Recipient rats were anesthetized and ventilated as described above, and anesthesia was maintained with 0.2% halothane, adjusted depending on heart rate and blood pressure. Through a neck incision, the left carotid artery was cannulated with a P60 catheter to measure arterial blood gas and monitor blood pressure via transducers. A baseline arterial blood gas level was measured from a 0.3-mL blood sample to assess the adequacy of mechanical ventilation. Through a left thoracotomy in the fifth intercostal space, the left lungs were removed, and the donor lungs transplanted by the technique above. Then, the transplanted lung was inflated to eliminate atelectasis. The success of transplant was determined by 3 items: no leakage of air and blood, full filling of pulmonary arteries and veins, and the transplanted lungs turned pink and flexible.
Experimental protocol
After transplant, in the control group, the pulmonary vessels were unclamped,
and reperfusion was restored, ending ischemic time. While in the IPo group, the
left pulmonary artery was given 5 cycles of 1 minute’s reperfusion and 1
minute’s reocclusion at the onset of reperfusion as postconditioning. Then, the
recipients were ventilated and observed for
4 hours.
Preparation of specimens
Arterial blood gas was obtained after snaring the right hilum at 10 minutes, 1
hour, 2 hours, and
4 hours after the onset of reperfusion. The animals were killed with intravenous
thiopental sodium, and portions of donor lungs were immediately frozen in liquid
nitrogen and stored at -70°C. A piece from the midportion of the donor graft was
excised and weighed. It was then dried in a 60°C oven for 48 hours and reweighed.
The ratio of wet/dry weight was calculated.
Measurement of malondialdehyde and superoxide dismutase activity
Lung tissues were homogenized on ice with normal saline. The homogenates were
centrifuged at 4000g minute-1 at 4°C for 10 minutes. The malondialdehyde level
in the supernatants was determined by measuring thiobarbituric acid-reactive
substances levels (assay kits was supplied by Nanjing Jiancheng Corp., Nanjing,
China) as previously described.12 The results were calculated as nmol•100 mg-1. Superoxide dismutase activity in the supernatants was evaluated by inhibition of
nitroblue tetrazolium reduction by O2- generated by the xanthine/xanthine
oxidase system (Nanjing Jiancheng Corp.) in accordance with the previous method.12 The results were expressed by U•100 mg-1 protein.
Assessment of apoptosis in donor grafts
Apoptosis in the donor graft was evaluated using terminal deoxynucleotidyl
transferase-mediated deoxyuridine-biofin nick end labeling enzyme method, which
identifies apoptotic cells in situ
by using terminal deoxynucleotidyl transferase
to transfer biotin-dUTP to the free 3'-OH of cleaved DNA. The biotin-labeled
cleavage sites are
then detected by a reaction with horseradish peroxidase conjugated streptavidin
and visualized by 3,3'-diaminobenzidine showing a brown color. The detailed
technique was described by Micoud and coworkers.13
Measurement of ICAM-1 mRNA
ICAM-1 mRNA level was measured by semiquantitative reverse transcriptase-polymerase
chain reaction method. Total cellular RNA was isolated using TRIzol reagent (Sangon,
Shanghai, China) in accordance with the manufacturer’s instructions. After
assessing purity of the final products by A value ratios at 260/280 nm, RNA
samples were reverse transcribed into cDNA by a reverse-transcription kit (Promega
Corporation, Madison, WI, USA). The ICAM-1 primers were
5’ TGTCAAACGGGAGATGAATGG 3’ (sense) and 3’ GGTAAATGTGGATAATGGCGGT 5’
(antisense). After amplification, polymerase chain reaction products were
electrophoresed through a 2% agarose gel with ethidium bromide (0.5 mg/L) to
visualize the DNA bands (ICAM-1/β-actin). The expected lengths of
polymerase chain reaction products were 186 bp. The results were analyzed by a
BF-300 image system and its software provided by Sixing Biotech (Shanghai,
China).
Statistical analyses
All data are represented as means ± standard deviation (SD). The data of
arterial blood gas were analyzed by repeated measurement ANOVA. All other data
were analyzed by a 2-sample t test to identify significant differences between
the experimental and control groups. Values for P < .05 were considered
statistically significant.
Results
In each group, 10 recipient rats underwent a single left lung transplants in situ with non–heart-beating donor lungs whose warm ischemic time was 36.7 ± 5.62 minute. No mortality was observed at the end of the experiment. Table 1 shows that that non–heart-beating donor and total ischemic time of the grafts were not significantly different between the 2 groups (P > .05).
Changes of PaO2 after reperfusion
Recipient arterial blood gases were measured at
10 minutes, 1 hour, 2 hours, and 4 hours from the onset of reperfusion after
lung transplant. To eliminate the influence of the right lungs, PaO2 was
measured solely from the transplanted left lung by snaring the right hilum. As
shown in Table 1, the mean PaO2 decreased as time passed in both groups, and it
was not significantly different between the
2 groups at 10 minutes and 1 hour. However, at
2 hours and 4 hours, the mean PaO2 was much higher in the IPo group than in the
control group
(P < .05), suggesting that the lung functions of the grafts in the IPo group
were preserved much better.
Changes in the wet/dry lung weight ratio
The wet-to-dry lung weight ratios were measured to evaluate fluid accumulation
in the transplanted lung specimens after reperfusion. The 20 left lung specimens
removed from the recipient rats before the transplant had a mean wet-to-dry lung
weight ratio of 3.86, which represents a control value of a normal lung.
Compared with the value of normal lungs, the wet-to-dry lung weight
ratios in both groups were increased, implying a significant increase in fluid
accumulation after lung transplant. However, as shown in Table 2, the mean
wet-to-dry lung weight ratio was significantly lower in the IPo group than it
was in the control group
(P < .05).
Changes of the level of malondialdehyde and the activity of superoxide dismutase
To detect the oxidative stress in the transplanted lungs, we measured the level
of malondialdehyde and the activity of superoxide dismutase of the transplanted
lungs. From Table 2, we found that compared with the control group, the mean
malondialdehyde levels of the transplanted lung tissues in the IPo group were
significantly lower
(P < .01) and the mean superoxide dismutase activities were highly increased (P
< .01).
Detection of apoptosis in donor grafts
We further tested apoptotic cells of the transplanted lungs using the terminal
deoxynucleotidyl transferase-mediated deoxyuridine-biofin nick end labeling
method by assessing DNA fragments of the apoptotic cells. The apoptotic cells
were counted under fluorescence microscope. Determined by the average number and
the average density of apoptotic cells, our results showed that apoptotic cells
of the IPo group were dramatically fewer than those of the control group (Table
2, Figure 1; P < .01).
Expression of ICAM-1 mRNA in donor grafts
Figure 2 illustrates that the ICAM-1 mRNA level was significantly lower in the
IPo group that in the control group.
Discussion
The latest data show that the long-term patient and graft survival rates of donation after cardiac death lung transplant are equivalent to those after brain death. However, non–heart-beating donors have been used infrequently for clinical lung transplant because unavoidable warm ischemia, with concomitant reperfusion injury, remains a limiting factor for transplanted lungs recovered from cardiac death donors. Some methods, such as topical cooling and nitroglycerin reperfusion or inhalation,14-17 have been introduced to facilitate lung donation after cardiac death.
In this study, we hypothesized that IPo was another approach to effectively reduce ischemic reperfusion injury of lungs recovered from non–heart-beating donors. Recent research18-20 has shown in that IPo is as effective as ischemic precondition in reducing ischemia/reperfusion-induced lung injury. However, whether IPo has such effects in non–heart-beating donor lungs and what are the optimal cycle numbers and duration of intermittent episodes, remain unknown. Zhang and associates,21 after collecting many materials, conclude that the duration of intermittent episodes might be species dependent, which is empirically shorter in small animals and longer in large animals and human beings, and the duration is more important than cycle numbers. Because IPo on reperfusion-initiated lung injury has been scarcely reported, we took 5 cycles of 1 minutes’ reperfusion and 1 minutes’ reocclusion as the algorithm of IPo, because in our preliminary test we found it effective in reducing ischemic reperfusion injury of ischemic lungs.
Recipient rats underwent a left single lung transplant in situ with grafts having more than 30 minutes warm ischemia after cardiac death that were then ventilated for 4 hours. A serial measure of PaO2 was used as the main variable when comparing lung function between groups. The results show that PaO2 decreased gradually as time passed in accord with development of ischemic reperfusion injury of the donor grafts, and that mean values of PaO2 were significantly higher at 2 hours and 4 hours in the IPo group than they were in the control group. All of which might suggest that IPo can preserve lung function by reducing ischemic reperfusion injury.
The injury experienced by transplanted lungs after reperfusion also could be reflected in the increase in wet-to-dry lung weight ratio. The wet-to-dry lung weight ratios were significantly higher in the transplanted lungs than they were in the normal lungs. However, compared with controls, the mean wet-to-dry lung weight ratio in the IPo group was lower. This indicates that IPo might attenuate fluid accumulation in the transplanted lung after reperfusion and improve lung function.
As reactive oxygen species have been thought to be an important contributor to reperfusion injury, we measured malondialdehyde and superoxide dismutase in this experiment. The results show that the level of malondialdehyde was reduced, and the activity of superoxide dismutase was higher, in transplanted lungs after 4 hours reperfusion in the IPo group compared with controls, indicating that reactive oxygen species generation during reperfusion was attenuated by IPo. At onset of reperfusion, there is a “respiratory burst” lasting several minutes, followed by moderately but persistently elevated production of superoxide anions. It is speculated that IPo may reduce reactive oxygen species generation by limiting delivery of oxygen during the rapidly repetitive occlusions. Conversely, limited blood flow at the onset of reperfusion may prevent the scavengers of reactive oxygen species, such as superoxide dismutase, from being massively flushed away.
Apoptosis is another factor resulting in reperfusion injury early after lung transplant.22 Recent studies23,24 have discovered that up-regulating the reperfusion injury salvage kinase pathway is one of the most important mechanisms in cardioprotection of IPo, including activation of phosphatidylinositol 3-kinase-Akt and/or extracellular signal-regulated kinase, which reduces apoptosis and necrosis by inhibiting the opening of mitochondrial permeability transition pore. The data in our study also show that apoptosis in the transplanted grafts was markedly reduced in the IPo group compared with the control group. However, the detailed mechanism needs further investigation.
Early after lung transplant, ICAM-1 expression in the transplanted lung is up-regulated, which is related to enhancement of ICAM-1 mRNA. As a ligand, ICAM-1 can bond with the receptor CD11/CD18 at the surface of neutrophil granulocytes, making neutrophil granulocytes migrate to tissue gaps and release inflammatory factors (eg, INF-α and IL-1β), which would further aggravate reperfusion injury of the transplanted graft. In our experiment, we noted that the ICAM-1 mRNA level was significantly lower in the IPo group than it was in the control group, which demonstrates that ischemic postconditioning could inhibit enhancement of ICAM-1 mRNA after transplant so as to down-regulate ICAM-1 expression, helping to reduce ischemic reperfusion injury.
In summary, the present study demonstrates that IPo has protective effects to non–heart-beating donor lungs in the rat lung transplant. It can preserve the structure and function of the transplanted lungs by reducing reactive oxygen species generation and inhibiting apoptosis and expression of ICAM-1 mRNA. Nonetheless, this hypothesis of IPo remains a purely experimental one and long-term observations are desired. Postconditioning is a promising means of facilitating lung transplant from non–heart-beating donors, because it is easy to manipulate and be combined with other protective strategies such as topical cooling and cold ventilation.
References:

Volume : 11
Issue : 1
Pages : 44 - 49
DOI : 10.6002/ect.2011.0161
From the Department of Cardiothoracic Surgery, Xiangya Hospital, Central-South
University, Changsha, Hunan Province, China
Acknowledgements: Hu Qing-hua is responsible for the concept and design of the
article,
Luo Fan-yan performed all the data collection, Luo Wan-jun performed a critical
revision of article, and Wang Lin was responsible for the statistical analyses
of the data collection. None of the authors reports any conflicts of interest
and they received no funding for this
study.
Corresponding author: Fan-yan Luo, Department of Cardiothoracic Surgery, Xiangya
Hospital, Central South University, Changsha, Hunan Province, China, 410078.
Phone: +86 0731 8975 3004
Fax: +86 0731 8432 7247
E-mail:
drlfy@163.com
Table 1. Ischemic Time (min) and PaO2 (mmHg)
Table 2. Wet/Dry Ratio, Malondialdehyde (nmol·100mg-1), Superoxide Dismutase (U·100mg-1), and the Number and Density of Apoptotic Cells
Figure 1. Apoptotic Cells of the Transplanted Lungs
Figure 2. RT-PCR Analysis for Detecting ICAM-1 mRNA of Lung Grafts