Key words : Graft rejection, Helios protein, Kidney transplant

Introduction

Despite considerable advances in the field of renal transplantation, acute T-cell-mediated rejection (TCMR) remains a major obstacle to allograft survival.¹ The immunosuppressive drugs for prevention and treatment of TCMR can impose metabolic disturbance and increase the susceptibility for various infectious and neoplastic disorders because of the nonspecific suppression of the immune system.² For this reason, there have been efforts to discover the critical pathways of immune responses for inhibition of alloreactive T lymphocytes in a more specific manner.³ Among proposed targets, members of the interferon regulatory factor (IRF) family, specifically IRF4, have been implicated in the development and function of T cells.⁴

Interferon regulatory factor 4, together with the other principal transcription factors (such as basic nuclear factor of activated T cells; RAR-related orphan receptor gamma; leucine zipper transcription factor, ATF-like; transcription factor PU.1; SMAD family member 2/3; and B-cell lymphoma 6), is involved in naive CD4⁺ T-cell differentiation into the effector subsets such as the helper T cells T_H2, T_H9, and T_H17, as well as follicular helper T cells.⁵ Moreover, IRF4 should limit the expression of PDCD1 and Helios molecules and thus enhance T-cell-mediated responses by protecting the effector T cells from activation-induced apoptosis and interfering with induction of regulatory T (Treg) cells.⁶

Programmed cell death 1 (PDCD1, also known as PD-1) is a member of the immunoglobulin super-family and is mainly involved in T-lymphocyte activation-induced cell death. Engagement of PDCD1 with its ligands PD-L1 and PD-L2 has been implicated in the induction and maintenance of peripheral tolerance and protection of tissues from autoimmune attacks.⁷ Apart from immature double-negative thymocytes, PDCD1 is inducibly expressed in T cells, B cells, and natural killer cells, as well as in monocytes, upon activation.⁸ Programmed cell death 1 regulates the activation of T lymphocytes in various stages of differentiation such as naive, effector, and memory cells.⁹ The immunomodulatory role of PDCD1/PD-L1 has been demonstrated in expe rimental models of transplant; specifically, PDCD1/PD-L1 blockade resulted in accelerated allograft rejection, whereas its stimulation improved allograft survival.^10-12

Helios (IKZF2 protein) is a member of the Ikaros transcription factor family, which participates in differentiation of natural Treg cells through upregulation of forkhead box P3 gene expression.¹³ In addition, Helios promotes survival and suppressive function of certain Treg-cell subsets14 and has been shown to upregulate in CD4+CD25+ Treg cells; specifically, suppression of Helios attenuated the suppressive activity of CD4⁺CD25⁺ Treg cells.¹³ Despite the remarkable function of Helios to regulate immune responses, there have been few investigations of its significance in transplant outcomes. One such study reported that the absolute count of Helios-positive Treg cells in stable renal transplant recipients is comparable with the levels in healthy individuals.¹⁵

Among numerous single-nucleotide poly-morphisms (SNP) of the IRF4 gene, the rs872071A>G and rs12203592C>T SNPs have been suggested to negatively affect IRF4 expression. The rs12203592C>T SNP is located on intron 4 and has been shown to induce defective IRF4 expression.¹⁶ The presence of the rs12203592C>T SNP is correlated with higher susceptibility to skin cancers.^17,18 The other SNP associated with lower IRF4 expression is rs872071A>G, which is located in the 3? untranslated region¹⁹ and considered a risk factor for hematologic malig-nancies.²⁰ The significant association of these 2 SNPs with cancers suggests an impaired T-cell surveillance due to the IRF4 insufficiency that predisposes patients with low-expressing genotypes to the malignancies.

There is considerable implication of IRF4 in expan-sion and function of T cells, and we aimed to compare the frequency of the rs872071A>G and rs12203592C>T genotypes of IRF4 and determine correlation, if any, with the gene expression of downstream molecules PDCD1 and Helios for stable recipients versus acute transplant recipients with TCMR.

Materials and Methods

Patients
Peripheral blood samples were collected from 60 adult renal transplant recipients with biopsy-proven acute TCMR before initiation of treatment. Sixty age-matched and sex-matched stable recipients (according to the clinical and laboratory criteria) were also enrolled in the study. All transplants were performed from unrelated deceased donors. The recipients with any active infectious, autoimmune, or allergic disease were excluded. The clinical, laboratory, and demog-raphic data of the patients are presented in Table 1.

Ethical approval
This study was approved by the Tehran University of Medical Sciences (code No. IR.TUMS.CHMC. REC.1397.043), and all the protocols with human participants were in accordance with the standards of the institutional research committee and with the Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all participants.

RNA extraction and complementary DNA synthesis
We isolated RNA with the High Pure RNA Isolation kit (ROJE Technologies) according to the manufacturer’s instructions. We assessed RNA quality with a spectrophotometer (NanoDrop ND-1000, Thermo Scientific); samples were deemed acceptable if the A₂₆₀/A₂₈₀ absorbance ratios were within the range of 1.8 to 2.2 and the A₂₆₀/A₂₃₀ ratios were 2 to 2.2. Reverse transcription of RNA to complementary DNA (cDNA) was performed with a Transcriptor First Strand cDNA Synthesis kit (ROJE Technologies). The cDNA quality was evaluated with a spectrophotometer, and samples with A₂₆₀/A₂₈₀ ratios of 1.7 to 2 were stored at -70 °C until use.

DNA extraction
Extraction of DNA from whole blood was performed by the salting-out method.²¹ For this procedure the cell is treated with a detergent, the proteins are removed with salt and proteinase K, RNA is eliminated with ribonuclease, and the DNA strands are precipitated with ethanol. The quality of the DNA was evaluated with a spectrophotometer, and samples with A₂₆₀/A₂₈₀ ratios of 1.7 to 2 were stored at -20 °C until use.

Gene expression assay
To quantify the relative expression of PDCD1 and Helios genes, we used the SYBR Green Gene Expression Assay with the real-time polymerase chain reaction (PCR) technique. The internal control gene for PDCD1 was glyceraldehyde-3-phosphate dehydrogenase, and ?-actin was the internal control for Helios. Primers for the gene expression assay were as follows (provided by Metabion): ?-actin, forward AATGAGCTGCGTGTGGCTCCC and reverse CAGGGATAGCACAGCCTGGATAGCA; Helios, forward CAACTATCTCCAGAATGTCAG and reverse TAATAGGCTCTTGTTCCTTAC; PDCD1, forward CAGCCTGGTGCTGCTAGTCTG and reverse GTCCACAGAGAACACAGGCAC; and glyceralde-hyde-3-phosphate dehydrogenase, forward GTCTCCTCTGACTTCAACAGCG and reverse ACCACCCTGTTGCTGTAGCCAA. Then, 10 ?L of master mix, 1 ?L assay mix (including forward and reverse primers), 7 ?L of distilled H2O, and  2 ?L of diluted sample cDNA (5 ng/?L) were added to the wells. The reaction  minutes at 95 °C, 45 cycles of 15 seconds at 95 °C, and 60 seconds at 60 °C, with a real-time PCR system (StepOnePlus, Applied Biosystems). All tests were performed in duplicate and analyzed by relative quantification. Two nontemplate controls were included in each run.²² To calculate the relative expres-sion between samples, we used the threshold cycle number (??Ct) as determined by the cycle threshold procedure, for which the relative expression is 2???Ct, where ??Ct = (?Ct of TCMR patients) ? (?Ct of stable recipients).²³

Gene polymorphism assay
The genotype analyses of rs12203592 and rs872071 were performed with TaqMan assays C_31918199_10 (Applied Biosystems) and C_8770093_20 (Applied Biosystems), respectively. According to the manufacturer’s protocol, 12.5 ?L of TaqMan master mix (Applied Biosystems), 1.5 ?L assay mix, and 10 ?L DNA (5 ng/?L) were mixed in 96-well plates. The temperatures of polymerase (10 minutes) and denaturation (15 seconds) were 95 °C; the annealing temperature (10 minutes) was 60 °C, repeated for 40 cycles via real-time PCR. The same system was used for subsequent end-point reading of the genotypes. Two negative controls were included in each PCR run.

Statistical analysis
Data are shown as mean values ± SD or SEM. To compare the relationship between quantitative variables within 2 groups, the independent sample t test was used. To investigate the relationship between qualitative variables, the Pearson chi-square test and the odds ratio test were performed. Nonparametric values were tested with the Mann-Whitney U test. P < .05 was considered significant. The graphs are shown as box plots or cluster bar charts (SPSS software, version 26.0).

Results

Expression of programmed cell death 1 and Helios genes in transplant recipients with T-cell-mediated rejection versus stable transplant recipients
The relative expression of PDCD1 gene in peripheral blood mononuclear cells of stable recipients was higher than for patients with acute TCMR (0.62 ± 0.35 vs 0.79 ± 0.49, mean ± SD; P = .03). Helios gene expression was lower in patients with TCMR compared with the stable transplant recipients, but this difference was not statistically significant (0.48 ± 0.35 vs 0.58 ± 0.39, mean ± SD; P = .16) (Figure 1).

Frequency of rs12203592C>T and rs872071A>G single-nucleotide polymorphisms of the interferon regulatory factor 4 gene in renal transplant recipients
The rs12203592C>T SNP of the IRF4 gene was detected in 7 of 120 patients (5.8%), 4 of whom were in the TCMR group (6.7%) and 3 were in the stable group (5%). The odds ratio was 1.375 (95% CI, 0.29-6.34) and was nonsignificant by the Pearson chi-square test (P = .69). The rs872071A>G SNP was found in 8 patients (6.7%), 3 of whom were in the TCMR group (5%) and 5 were in the stable group (8.3%). The odds ratio was 0.58 (95% CI, 0.13-2.54), and the Pearson chi-square test (P = .46) indicated no significant difference across groups (Figure 2).

Association of the rs12203592C>T single-nucleotide polymorphism with expression of programmed cell death 1 and Helios genes in renal transplant recipients
The gene expression of PDCD1 in patients with the rs12203592C>T SNP (n = 7) was higher than in the patients without this SNP (n = 113) (1.02 ± 0.11 vs 0.69 ± 0.04, mean ± SEM), but this finding was not significant (P = .049). Given that the presence of the rs12203592C>T SNP is known to reduce expression of the IRF4 gene, this finding could be attributed to the decreased inhibition of PDCD1 by IRF4. Furthermore, the patients with the rs12203592C>T SNP (n = 7) showed slightly higher levels of Helios gene expres-sion versus the patients without this SNP (n = 113) (0.78 ± 0.08 vs 0.52 ± 0.03, mean ± SEM), but these results were not statistically significant (P = .054) (Figure 3).

Association of the rs872071A>G single-nucleotide polymorphism with expression of programmed cell death 1 and Helios genes in renal transplant recipients
The rs872071A>G SNP of the IRF4 gene showed no significant association with PDCD1 gene expression; despite a minor elevation in rs872071A>G-positive patients, PDCD1 expression was comparable between the groups (0.85 ± 0.07 vs 0.69 ± 0.04, mean ± SEM; P = .17). However, the recipients with the rs872071A>G SNP (n = 8) showed higher levels of Helios gene expression compared to the rs872071A>G- negative group (n = 112), which emphasized the inhibitory effect of IRF4 on Helios gene expression (0.88 ± 0.09 vs 0.5 ± 0.03, mean ± SEM; P = .008) (Figure 4).

Discussion

In recent years, IRF4 has raised interest among researchers in various clinical areas. Overexpression of IRF4 has already been demonstrated in certain rheumatologic diseases such as rheumatoid arthritis, systemic lupus erythematosus, and systemic sclerosis.^24,25 Moreover, cancer studies have implicated IRF4 in a wide range of hematologic and nonhematologic malignancies, based on the reports of the association of aberrant IRF4 expression with lymphoma, multiple myeloma, melanoma, non-small cell lung cancer, and many other cancers.^26,27 In the field of transplantation, animal experiments have shown positive effects of IRF4 gene deletion or suppression on allograft survival. For example, IRF4 inhibition by IRF4 small interfering RNA (IRF4-siRNA) resulted in lower levels of the proinflammatory cytokines tumor necrosis factor, interferon ? (IFN-?), and interleukin 6 (IL-6); higher levels of anti-inflammatory cytokine IL-10; enhanced M2 macrophages differentiation; lower scores of acute rejection; and improved outcomes in mouse liver transplants.²⁸ It was also found that the calcineurin inhibitor tacrolimus exerts part of its immunosup-pressive function through downregulation of IRF4 gene expression.²⁹ Likewise, in a mouse model of renal transplant rejection, proliferation and differentiation of CD4⁺ follicular helper T cells were suppressed by bortezomib through increased expression of microRNA 15b (Mir15b), which inhibits IRF4 expression.³⁰ Wu and colleagues demonstrated that IRF4 inhibition resulted in overexpression of the PDCD1 and Helios genes and improved survival of mouse heart allografts. Furthermore, heart transplant from IRF4-deficient mice showed significantly better outcomes compared with the wild type. Wu and colleagues also reported that CD4⁺ T cells are the main target of suppression by IRF4 deletion. Dysfunction of T cells due to the IRF4 suppression was shown to be irreversible after 30 days, and as such, IRF4 is an appealing target for prevention of allograft rejection.³¹

Our previous study demonstrated comparable results in renal transplant. We found significantly higher expression of the IRF4 gene in patients with acute TCMR compared with the stable recipients. Moreover, there was a negative correlation between IRF4 gene expression and the frequency of PDCD1 and Helios molecules in peripheral blood mononuclear cells of transplant recipients.³² Therefore, in the present study, we investigated the effect of the low-expressing SNPs of the IRF4 gene on allograft outcome and the influence of these SNPs on the expression of downstream regulatory molecules PDCD1 and Helios. Two IRF4 gene SNPs, rs872071A>G and rs12203592C>T, located in the 3? untranslated region and intron 4, respectively, have been associated with impaired expression of IRF4 and susceptibility to certain malignancies.^16-20 However, the effects of these polymorphisms on transplant have not yet been reported. The rs12203592C>T SNP was found in 7 of 120 renal transplant recipients, 3 of whom were in the stable group and 4 were in the TCMR group. The rs872071A>G SNP was observed in 8 patients, 5 of whom were in the stable group and 3 were in the TCMR group. Only a few patients possessed these SNPs, so our results are inconclusive; nonetheless, there was a slight positive correlation between the presence of low-expressing polymorp-hisms and the expression of the PDCD1 and Helios genes. Although this finding may be disputed on the basis of the uneven distribution of SNP-positive and SNP-negative patients, it confirms the previous findings of the inhibitory role of IRF4 on the PDCD1 and Helios regulatory molecules. Obviously, larger studies in populations with higher frequencies of the rs872071A>G and rs12203592C>T SNPs are required to fully understand the significance of impaired IRF4 expression in solid-organ transplants.

The PDCD1 molecule is a surface receptor expressed on major lymphocytic subtypes that participates in limiting immune responses through induction of exhausted phenotype and apoptosis in activated T cells, B cells, and natural killer cells. Recent studies have implicated PDCD1 in tumor-induced immunosuppression; therefore, there have been efforts to block the PDCD1/PD-L1 interaction with monoclonal antibodies to improve antitumor immune responses.³³ However, PDCD1 engagement with its ligands appears to have positive effects on allograft survival. It has been reported that the expression of PD-L1 on donor cardiac tissue could regulate the recipients’ alloimmune responses and reduce allograft rejection scores and posttransplant vasculopathy.¹¹ In a hematopoietic stem cell transplant study, inhibition of PDCD1 signaling was observed to induce aggressive expansion of CD4+ conventional T cells and subsequent development of severe graft-versus-host disease.³⁴ Another experiment showed accelerated rejection of major histocompatibility complex II-mismatched skin allograft after PD-L1 blockade. In addition, an in vivo study demonstrated that PD-L1 blockade caused enhancement of T-cell proliferation and alloreactive T_H1-cell differentiation in addition to significant inhibition of apoptosis in alloantigen-specific T cells.³⁵ These and other findings suggest a critical role for PDCD1/PD-L1 interactions in the regulation of alloimmune responses. Results of the present study also demonstrated a significant reduction of PDCD1 gene expression in patients with TCMR compared with the stable recipients. Moreover, we observed a direct association between PDCD1 expression and the rs12203592C>T SNP, which indicates a positive effect of IRF4 suppression on the expression of the PDCD1 immunoregulatory molecule.

The association of Helios transcription factor with transplant outcome has rarely been studied. One study showed that both higher glomerular filtration rate and lower serum creatinine were associated with the frequency of IFN??-negative/Helios-positive Treg cells.³⁶ The same researchers found similar absolute counts of IFN-?-producing Helios-positive and Helios-negative Treg cells in stable renal transplant recipients and healthy controls.¹⁵ Our previous investigation demonstrated a higher frequency of Helios molecules in peripheral blood mononuclear cells of the stable patients versus the patients with TCMR.³² Similarly, the present study showed lower expression of the Helios gene in the TCMR group compared with the stable group, but this was not statistically significant. Nonetheless, there was a significant correlation between Helios gene expression and the rs872071A>G SNP, as well as a minor association with the rs12203592C>T SNP.

These results suggest a negative role for IRF4 in transplant, and we propose IRF4 as a target of suppression for the prevention and treatment of TCMR. On the other hand, the critical role of IRF4 in development, proliferation, and activation of lymphocytes should be considered carefully because the complete lack of IRF4 in knockout models or severely impaired expression of the IRF4 gene has caused serious defective immune responses.³⁷

Although the present study has focused on the implication of IRF4 in TCMR, antibody-mediated rejection may also be affected by the expression level of this critical transcription factor. It has been demonstrated that IRF4 (as well as IRF8) is profoundly involved in B-lymphocyte development and maturation including pre-B-cell differentiation, B-cell proliferation, marginal zone B-cell development, germinal center reaction, and plasma cell differentiation.^37,38 Therefore, blockage of IRF4 may also be beneficial for prevention of antibody-mediated rejection, particularly in presensitized transplant recipients.

According to the critical role of IRF4 to develop effective immune responses and the negative consequences of its overexpression in transplant and autoimmunity, partial inhibition of IRF4 may be recommended for management of certain clinical situations. For example, Yang and colleagues showed that IRF4 inhibition with IRF4-siRNA reduced infiltration of T_H1 cells and T_H17 cells and increased the number of Treg cells in brain tissue and thereby ameliorated experimental autoimmune encephalomyelitis. Also, IRF4-siRNA could limit the differentiation of T_H1 and T_H17 cells both in vivo and in vitro. Moreover, in the dendritic-cell/T-cell coculture system, IRF4-siRNA-treated dendritic cells induced lower IFN-? and IL-17 secretion from T lymphocytes. It was also observed that adoptive transfer of CD11c+ dendritic cells from IRF4-siRNA-treated mice reduced the scores for experimental autoimmune encephalomyelitis; these dendritic cells exhibited lower expression of tumor necrosis factor and IL-6 but higher secretion of IL-10.³⁹ Another study reported that selective targeting of IRF4 by synthetic microRNA-125b-5p impaired the growth and survival of multiple myeloma cells in the bone marrow. Moreover, the expression of IRF4 mRNA inversely correlates with microRNA-125b-5p in patients with multiple myeloma.⁴⁰ Finally, there is evidence of downregulation of IRF4 levels in a multiple myeloma cell line and bone marrow samples after administration of lenalidomide, a drug used to treat hematologic malignancies in combination with chemotherapy.⁴¹

Conclusions

Overall, our observations suggest that IRF4 plays an unfavorable role in transplant by its effects on the differentiation and activation of alloreactive T lymphocytes, whereas the expressions of immunoregulatory molecules PDCD1 and Helios inversely correlate with IRF4 expression. Therefore, IRF4 inhibition may be a therapeutic option to limit T-cell-mediated alloimmune responses and selective immunosuppression after transplant. However, further studies are required to determine optimal methods to control the expression and function of IRF4 in a manner that does not interfere with development of efficient immune responses against microbial and neoplastic antigens.

References:

1. Kaplan B. Decade in review: renal transplantation: a spectrum of advances in renal transplantation. Nat Rev Nephrol. 2015;11(11):639-641. doi:10.1038/nrneph.2015.159
   CrossRef - PubMed
   
2. McDonald-Hyman C, Turka LA, Blazar BR. Advances and challenges in immunotherapy for solid organ and hematopoietic stem cell transplantation. Sci Transl Med. 2015;7(280):280rv2. doi:10.1126/scitranslmed.aaa6853
   CrossRef - PubMed
   
3. Alegre ML, Goldstein DR, Chong AS. Toll-like receptor signaling in transplantation. Curr Opin Organ Transplant. 2008;13(4):358-365. doi:10.1097/MOT.0b013e3283061149
   CrossRef - PubMed
   
4. Assadiasl S, Shahi A, Salehi S, Afzali S, Amirzargar A. Interferon regulatory factors: where to stand in transplantation. Transpl Immunol. 2018;51:76-80. doi:10.1016/j.trim.2018.10.001
   CrossRef - PubMed
   
5. Huber M, Lohoff M. IRF4 at the crossroads of effector T-cell fate decision. Eur J Immunol. 2014;44(7):1886-1895. doi:10.1002/eji.201344279
   CrossRef - PubMed
   
6. Man K, Gabriel SS, Liao Y, et al. Transcription factor IRF4 promotes CD8(+) T cell exhaustion and limits the development of memory-like T cells during chronic infection. Immunity. 2017;47(6):1129-1141.e5. doi:10.1016/j.immuni.2017.11.021
   CrossRef - PubMed
   
7. Jin HT, Ahmed R, Okazaki T. Role of PD-1 in regulating T-cell immunity. Curr Top Microbiol Immunol. 2011;350:17-37. doi:10.1007/82_2010_116
   CrossRef - PubMed
   
8. Francisco LM, Sage PT, Sharpe AH. The PD-1 pathway in tolerance and autoimmunity. Immunol Rev. 2010;236:219-242. doi:10.1111/j.1600-065X.2010.00923.x
   CrossRef - PubMed
   
9. Cai G, Karni A, Oliveira EM, Weiner HL, Hafler DA, Freeman GJ. PD-1 ligands, negative regulators for activation of naive, memory, and recently activated human CD4+ T cells. Cell Immunol. 2004;230(2):89-98. doi:10.1016/j.cellimm.2004.09.004
   CrossRef - PubMed
   
10. Wang L, Han R, Hancock WW. Programmed cell death 1 (PD-1) and its ligand PD-L1 are required for allograft tolerance. Eur J Immunol. 2007;37(10):2983-2990. doi:10.1002/eji.200737583
    CrossRef - PubMed
    
11. Yang J, Popoola J, Khandwala S, et al. Critical role of donor tissue expression of programmed death ligand-1 in regulating cardiac allograft rejection and vasculopathy. Circulation. 2008;117(5):660-669. doi:10.1161/CIRCULATIONAHA.107.741025
    CrossRef - PubMed
    
12. del Rio ML, Buhler L, Gibbons C, Tian J, Rodriguez-Barbosa JI. PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 2008;21(11):1015-1028. doi:10.1111/j.1432-2277.2008.00726.x
    CrossRef - PubMed
    
13. Getnet D, Grosso JF, Goldberg MV, et al. A role for the transcription factor Helios in human CD4(+)CD25(+) regulatory T cells. Mol Immunol. 2010;47(7-8):1595-1600. doi:10.1016/j.molimm.2010.02.001
    CrossRef - PubMed
    
14. Sebastian M, Lopez-Ocasio M, Metidji A, Rieder SA, Shevach EM, Thornton AM. Helios controls a limited subset of regulatory T cell functions. J Immunol. 2016;196(1):144-155. doi:10.4049/jimmunol.1501704
    CrossRef - PubMed
    
15. Trojan K, Unterrainer C, Weimer R, et al. Helios expression and Foxp3 TSDR methylation of IFNy+ and IFNy- Treg from kidney transplant recipients with good long-term graft function. PLoS One. 2017;12(3):e0173773. doi:10.1371/journal.pone.0173773
    CrossRef - PubMed
    
16. Han J, Qureshi AA, Nan H, et al. A germline variant in the interferon regulatory factor 4 gene as a novel skin cancer risk locus. Cancer Res. 2011;71(5):1533-1539. doi:10.1158/0008-5472.CAN-10-1818
    CrossRef - PubMed
    
17. Wang S, Yan Q, Chen P, Zhao P, Gu A. Association of interferon regulatory factor 4 gene polymorphisms rs12203592 and rs872071 with skin cancer and haematological malignancies susceptibility: a meta-analysis of 19 case-control studies. BMC Cancer. 2014;14:410. doi:10.1186/1471-2407-14-410
    CrossRef - PubMed
    
18. Wu M, Cao Y, Liu YL, Ma LL, Yang XH. Meta-analysis of the correlation between interleukin-6 promoter polymorphism -174G/C and interferon regulatory factor 4 rs12203592 polymorphism with skin cancer susceptibility. Am J Ther. 2016;23(6):e1758-e1767. doi:10.1097/MJT.0000000000000429
    CrossRef - PubMed
    
19. Di Bernardo MC, Crowther-Swanepoel D, Broderick P, et al. A genome-wide association study identifies 20 six susceptibility loci for chronic lymphocytic leukemia. Nat Genet. 2008;40(10):1204-1210. doi:10.1038/ng.219
    CrossRef - PubMed
    
20. Broderick P, Cunningham D, Vijayakrishnan J, et al. IRF4 polymorphism rs872071 and risk of Hodgkin lymphoma. Br J Haematol. 2010;148(3):413-415. doi:10.1111/j.1365-2141.2009.07946.x
    CrossRef - PubMed
    
21. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215. doi:10.1093/nar/16.3.1215
    CrossRef - PubMed
22. Assadiasl S, Ahmadpoor P, Nafar M, et al. Regulatory T cell subtypes and TGF-beta1 gene expression in chronic allograft dysfunction. Iran J Immunol. 2014;11(3):139-152.
    CrossRef - PubMed
    
23. Sharbafi MH, Assadiasl S, Pour-Reza-Gholi F, et al. TLR-2, TLR-4 and MyD88 genes expression in renal transplant acute and chronic rejections. Int J Immunogenet. 2019;46(6):427-436. doi:10.1111/iji.12446
    CrossRef - PubMed
    
24. Rodriguez-Carrio J, Lopez P, Alperi-Lopez M, Caminal-Montero L, Ballina-Garcia FJ, Suarez A. IRF4 and IRGs delineate clinically relevant gene expression signatures in systemic lupus erythematosus and rheumatoid arthritis. Front Immunol. 2018;9:3085. doi:10.3389/fimmu.2018.03085
    CrossRef - PubMed
    
25. Lopez-Isac E, Martin JE, Assassi S, et al. Brief Report: IRF4 newly identified as a common susceptibility locus for systemic sclerosis and rheumatoid arthritis in a cross-disease meta-analysis of genome-wide association studies. Arthritis Rheumatol. 2016;68(9):2338-2344. doi:10.1002/art.39730
    CrossRef - PubMed
    
26. Qian Y, Du Z, Xing Y, Zhou T, Chen T, Shi M. Interferon regulatory factor 4 (IRF4) is overexpressed in human nonsmall cell lung cancer (NSCLC) and activates the Notch signaling pathway. Mol Med Rep. 2017;16(5):6034-6040. doi:10.3892/mmr.2017.7319
    CrossRef - PubMed
    
27. Wang L, Yao ZQ, Moorman JP, Xu Y, Ning S. Gene expression profiling identifies IRF4-associated molecular signatures in hematological malignancies. PLoS One. 2014;9(9):e106788. doi:10.1371/journal.pone.0106788
    CrossRef - PubMed
    
28. Zhao W, Zhang Z, Zhao Q, Liu M, Wang Y. Inhibition of interferon regulatory factor 4 attenuates acute liver allograft rejection in mice. Scand J Immunol. 2015;82(3):262-268. doi:10.1111/sji.12318
    CrossRef - PubMed
    
29. Tang T, Lu Q, Yang X, et al. Roles of the tacrolimus-dependent transcription factor IRF4 in acute rejection after liver transplantation. Int Immunopharmacol. 2015;28(1):257-263. doi:10.1016/j.intimp.2015.06.014
    CrossRef - PubMed
    
30. Liu L, Wang ZG, Pang XL, et al. Bortezomib ameliorates acute allograft rejection after renal transplant by inhibiting Tfh cell proliferation and differentiation via miR-15b/IRF4 axis. Int Immunopharmacol. 2019;75:105758. doi:10.1016/j.intimp.2019.105758
    CrossRef - PubMed
    
31. Wu J, Zhang H, Shi X, et al. Ablation of transcription factor IRF4 promotes transplant acceptance by driving allogenic CD4(+) T cell dysfunction. Immunity. 2017;47(6):1114-1128.e6. doi:10.1016/j.immuni.2017.11.003
    CrossRef - PubMed
    
32. Freidoon M, Pour-Reza-Gholi F, Alamdari A, et al. Comparing IRF-4 gene expression between acute T cell-mediated rejection and stable renal transplant recipients. Iran J Kidney Dis. 2021;15(3):222-228.
    CrossRef - PubMed
    
33. Patsoukis N, Wang Q, Strauss L, Boussiotis VA. Revisiting the PD-1 pathway. Sci Adv. 2020;6(38):eabd2712. doi:10.1126/sciadv.abd2712
    CrossRef - PubMed
    
34. Ikegawa S, Meguri Y, Kondo T, et al. PTCy ameliorates GVHD by restoring regulatory and effector T-cell homeostasis in recipients with PD-1 blockade. Blood Adv. 2019;3(23):4081-4094. doi:10.1182/bloodadvances.2019000134
    CrossRef - PubMed
    
35. Sandner SE, Clarkson MR, Salama AD, et al. Role of the programmed death-1 pathway in regulation of alloimmune responses in vivo. J Immunol. 2005;174(6):3408-3415. doi:10.4049/jimmunol.174.6.3408
    CrossRef - PubMed
    
36. Trojan K, Zhu L, Aly M, et al. Association of peripheral NK cell counts with Helios(+) IFN-gamma(-) Tregs in patients with good long-term renal allograft function. Clin Exp Immunol. 2017;188(3):467-479. doi:10.1111/cei.12945
    CrossRef - PubMed
    
37. Hagman J. Critical functions of IRF4 in B and T lymphocytes. J Immunol. 2017;199(11):3715-3716. doi:10.4049/jimmunol.1701385
    CrossRef - PubMed
    
38. Shukla V, Lu R. IRF4 and IRF8: governing the virtues of B lymphocytes. Front Biol (Beijing). 2014;9(4):269-282. doi:10.1007/s11515-014-1318-y
    CrossRef - PubMed
    
39. Yang C, He D, Yin C, Tan J. Inhibition of interferon regulatory factor 4 suppresses Th1 and Th17 cell differentiation and ameliorates experimental autoimmune encephalomyelitis. Scand J Immunol. 2015;82(4):345-351. doi:10.1111/sji.12334
    CrossRef - PubMed
    
40. Morelli E, Leone E, Cantafio ME, et al. Selective targeting of IRF4 by synthetic microRNA-125b-5p mimics induces anti-multiple myeloma activity in vitro and in vivo. Leukemia. 2015;29(11):2173-2183. doi:10.1038/leu.2015.124
    CrossRef - PubMed
    
41. Lopez-Girona A, Heintel D, Zhang LH, et al. Lenalidomide downregulates the cell survival factor, interferon regulatory factor-4, providing a potential mechanistic link for predicting response. Br J Haematol. 2011;154(3):325-336. doi:10.1111/j.1365-2141.2011.08689.x
    CrossRef - PubMed