Objectives: We examined the use of a new approach in nanotechnology and stem cell research as regene-rative therapy for bone tissue defects. Materials and Methods: We compared in vitro osteo-genic potential of human Wharton jelly mesenchymal stem cells using coral granules and poly-L-lactic acid nanofiber according to proliferation (by cck-8 kit) and osteogenes (runt?related transcription factor 2, alkaline phosphatase, osteonectin) by quantitative reverse transcription-polymerase chain reaction, alkaline phosphatase assay, calcium measurement, and assessment of mineralization by Alizarin red and von Kossa staining. To overcome the limitations of natural coral, we made a modification by packaging the coral granules-human Wharton jelly mesenchymal stem cells by nanomembrane-human Wharton jelly mesenchymal stem cells to form sandwich double cell sheets and compared this hole with other holes (one was filled by human Wharton jelly mesenchymal stem cell suspension, and the other was filled by coral granules saturated with preinduced mesenchymal stem cells) by radiological and histopathological studies for repairing the bone gap. Results: Collagen-coated poly-L-lactic acid showed higher mRNA levels for all osteogenes (P < .001), higher alkaline phosphatase and calcium content
(P < .001), and greater stainability. Our in vivo experiment showed that the holes implanted with sandwich double cell sheet-poly-L-lactic acid coral were completely filled mature compact bone. The holes implanted with human Wharton jelly mesenchymal stem cells alone were filled with immature compact bone. Holes implanted with coral granules-human Wharton jelly mesenchymal stem cells were filled with condensed connective tissue. Conclusions: Poly-L-lactic acid nanofiber has greater osteogenic differentiating effect than the coral granules. The new approach of sDCS-PLLA-coral construct proved success for bone regeneration and repairing the bone gap and this may improve the design of tissue constructs for bone tissue regenerative therapy.

Key words : Bone tissue regeneration, Human Wharton jelly mesenchymal stem cells, Nanofiber scaffolds, Sandwich double stem cell sheet

Introduction

Bone defects are one of the leading causes of disability affecting the quality of life. Replacement of bone in patients with bone diseases and osteoporosis-related fractures and for tumor resections, trauma and congenital bone malformations, and autologous bone grafts is still considered the best choice for reconstruction of bone defects.1-5 Although it is superior to allografts and osteogenic properties and easier incorporation,6 the application of bone grafts is usually limited by the increased rate of donor site morbidity and the limited amount of bone tissue that can be retrieved.⁷

The use of allografts and xenografts is accompanied with reduction of donor morbidity rates, and these grafts provide unlimited supply of graft materials.7-10 On the other hand, the clinical application of allografts and xenografts is usually hindered by the risk of immune rejection and pathogen transmission.^7,11,12 Therefore, it is pivotal to find alternative grafts. Bone tissue engineering has emerged as an alternative therapeutic strategy to reduce the shortcomings of current clinical treatments.

Several synthetic biomaterials have been used in tissue engineering and have been evaluated as bone substitutes (tricalcium phosphate, ceramics, cements, and hydroxyapatite); however, these biomaterials do not mimic the natural bone in their porosity and architecture and have disadvantages regarding biocompatibility and host tissue integration.¹³ Coral is a natural biomaterial with porous architecture and calcium carbonate composition that is similar to human trabecular bone. In addition, coralline possesses the advantages of good availability, good osteoconductivity, and high biocompatibility.^9,13,14

Other biomaterials used in tissue engineering are nanofiber scaffolds, which are used for local or systemic delivery of drugs and growth hormones. Nanofibers have been studied for culture of stem cells either in vitro or in vivo as a support and delivery of growth factor and drugs for a length of time before degradation.^15-17 To improve tissue engineering toward the aim of bone remodeling by biomaterials, stem cells are usually added to make three-dimensional (3D) structures. Human Wharton jelly mesenchymal stem cells (HWJSCs) have advantages over bone marrow mesenchymal stem cells as a noninvasive source, have been shown to not affect health of the donor site, have greater proliferative capacity, and are less immunogenic.¹⁸

Tissue engineering for bone regeneration continues to have certain challenges regarding vascularization efficiency and with regard to the properties of the biomaterials used for the regulation of cellular mechanotransduction and cell behavior, which affect the proliferation, differentiation, and regeneration of tissues. More effective therapies are needed for bone defects in response to the demand for bone biomaterials. Selection of key components used for construction of the scaffold, extracellular matrix, and cells and their combination is a crucial step. In this study, we compared the in vitro osteogenic differentiating capacity of HWJSCs alone and in combination with either coral granules or collagen coated poly-L-lactic acid (PLLA) nanomembrane. We also performed an in vivo study, in which we created a new modification of the scaffold structure by covering the coral granules that saturated by induced HWJSCs allaround by PLLA nanomembrane after 21-day in vitro cultivation of HWJSCs to form sandwich double cell sheet (sDCS) around the coral granules for using this structure to repair a bone defect, hypothesizing that this structure will enhance proliferation, differentiation, and osteogenesis.

Materials and Methods

In vitro study

We prepared 2 scaffolds (coral granule scaffold and collagen-coated PLLA nanofiber scaffold) with isolated and characterized HWJSCs. For in vitro  group 1 included HWJSCs induced into osteogenic lineage, group 2 had coral granules saturated with osteogenic-induced HWJSCs, and group 3 had collagen-coated PLLA nanomembrane with osteogenic-induced HWJSCs. For each group, we determined the cell proliferation and assessed the differentiation of HWJSCs into osteogenic lineage by real-time quan-titative reverse transcription-polymerase chain reaction (qRT-PCR) for genes specific for osteogenic differen-tiation (runt?related transcription factor 2 [RUNEX], alkaline phosphatase [ALP], and osteonectin), measured calcium content, performed an ALP assay, and stained using Alizarin red and von Kossa stains.

In vivo animal study

Our in vivo study included 9 apparently healthy male dogs of native breed weighing 20 to 25 kg. Animals were prepared in an area in proximity to the operation room and transported to the operation room, which has a completely aseptic environment and is maintained under high-efficiency particulate air filter by the surgical facility manager. Three 9-mm diameter holes were created at the proximal third of the tibia using autoclaved sterile instruments.

Animals were compared according to the type of treatment. Group A (HWJSCs) included hole 1 implanted with HWJSCs suspension (containing 20 × 106 cell) preinduced into osteogenic lineage alone. Group B (coral granules-HWJSCs) included hole 2 filled with coral granules saturated with preinduced mesenchymal stem cells (MSCs). Group C (sDCS-coral/nano+) included hole 3 packed with coral granules saturated with preinduced MSCs coated as sandwich by PLLA nanomembrane with induced mesenchymal stem cells. Healing was evaluated using sequential radiography and histopathological examination of implanted holes at the end of each observation period.

The study protocol was approved by the review committee in the faculty of veterinary medicine, University of Sadat City, Egypt, for the use and human care of animals, which complied with the European Union Directive 2010/63/EU for animal experiments. The study was performed in the Clinical Pathology Department, Faculty of Medicine, Menoufia University, and the Faculty of Veterinary Medicine, Sadat University, from November 2020 to May 2022.

Preparation of the coral granule scaffold

Irregular granules were obtained by crushing coral fingers (Porites astreoides), which had been washed in 0.9% distilled water, using a mortar and pestle. Granules were subsequently sieved to achieve particles of only 200 to 300 μm. Granules were examined with a scanning electron microscope (SEM) and sterilized by autoclaving at 121 °C for 20 minutes, after which they were stored at room temperature until use.¹⁹

Preparation of the collagen-coated poly-L-lactic acid nanofiber scaffold

Poly L-lactic acid (Sigma Aldrich) has an average molecular weight of 85?000 g/mol; PLLA was dissolved in chloroform (Sigma Aldrich) and N,N-dimethylformamide (Sigma Aldrich) at a concent-ration of 8% weight. Sheets of PLLA scaffold were produced by electrospinning using syringe and needle, which were connected to a high-voltage supply and cylindrical drum at a distance of 15 cm to collect the sheets. The produced membranes were cut into 3-cm sections to be used in culture.

After sterilization of nanofiber membranes by ethanol and ultraviolet, the collagen from rat tail type I (Sigma Aldrich, USA) was dissolved at 1 mg/mL, which was used to cover the surface of the scaffold overnight. The scaffold was washed with phosphate-buffered saline and used for cell seeding.

After scaffolds were dried with absolute ethanol and sputter coated with gold, the diameter and the distribution of the electrospun PLLA nanofiber scaffold were measured and examined by SEM (JEOL JSM-6510LV) before and after seeding of the cells.

Isolation and characterization of human Wharton jelly mesenchymal stem cells

Human Wharton jelly-derived mesenchymal stem cells were isolated from healthy umbilical cord tissue samples (n = 20) according to a previously described protocol.20 The retrieved MSCs were characterized by microscopic examination and by flowcytometric analysis for phycoerytherin (PE) CD34 (Imunostep), PE CD44, fluorescein isothiocyanate Oct3/4, PE CD90, and fluorescein isothiocyanate CD45 (BD Pharminogen). We incubated 100 μL of cell suspension with 10 μL monoclonal antibody, incubated in the dark at 4 °C for 20 minutes. The tubes were washed with 2 mL of phosphate-buffered saline at 1800 revolutions/min for 5 minutes. After the gating procedure on CD45 negative cells, we used Becton Dickinson software (BD Biosciences) for analysis.

Seeding human Wharton jelly mesenchymal stem cells on the scaffolds

The coral granules and 3-cm parts of collagen-coated PLLA nanomembrane (as separate scaffolds) were transferred to 35-mm Petri dishes, and passage 2 HWJSCs were seeded on the scaffolds, covered by basal medium containing Dulbecco’s modified eagle’s medium L/G, 10% fetal bovine serum, and penicillin/streptomycin, and incubated for 24 hours at 37 °C and 5% CO2.

For osteogenic differentiation, the basal medium was replaced with an osteogenic medium, which contained Dulbecco’s modified eagle’s medium supplemented with 10% fetal bovine serum, 50 mg/mL ascorbic acid 2?phosphate, 10 nM dexamethasone, and 10 mM ??glycerophosphate. The samples were placed in an incubator at 37 °C and 5% CO2 for 21 days using the different cultured groups (groups 1-3, as described above).

Determination of cell proliferation

Cell proliferation in the different groups was performed by culturing an equal number of cells in 96-well plates for 72 hours, with light absorbance at 450 nm measured using a cell counting kit (cck-8; Sigma-Aldrich).

Assessment of differentiation of human Wharton jelly mesenchymal stem cells into osteogenic lineage in different scaffolds

RNA extraction and polymerase chain reaction

Total RNA was isolated from the different cultured groups (at passage 2 of HWJSCs, at passage 0 of induced HWJSC on coral scaffolds, and at passage 0 of induced HWJSC on collagen-coated PLLA nanofiber scaffold) using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions. We performed qRT-PCR as previously described.13 A 2-step PCR was done, and 8 μL of RNA was reverse transcribed into cDNA using MultiScribe reverse transcriptase according to the manufacturer’s protocol. We added 5 μL of cDNA to the final PCR reaction mixture of 25 μL containing 12.5 μL Master Mix SYBR green dye (Applied Biosystem), 1.5 μL of each primer, and 4.5 μL RNase-free water. Cycling conditions were 2 minutes at 94 °C as a first denaturation step, followed by 40 cycles of 15 seconds at 94 °C, 30 seconds at 60 °C (annealing), and 30 seconds at 72 °C.

The primers used in this study were specific for determination of osteogenic differentiation as follows. For RUNEX, forward and reverse were CCT AGG CGC ATT TCA GGT GCTT and CTG AGG TGA CTG GCG GGG TGT; for ALP, forward and reverse were GAC CCT TGA CCC CCA CAAT and GCT CGT ACT GCA TGT CCCCT; for osteonectin, forward and reverse were CGCAGCCACCGAGACACCAT and GGGCAAGGGCAAGGGGAAGA; for ?-actin control gene, forward and reverse were GAAAGCAAT-GCTATCACCTC  and GTTTGATTGCACATTGTTGT. The relative quantitation values of the mean expression levels were measured in relation to mean value of expression in control samples using the 2-(??CT), and this is more appropriate statically than fold-change expression to make the comparison between the different groups.

Alkaline phosphatase assay

Alkaline phosp-hatase was measured at different time points (on days 7, 14, and 21) from the different cultures. At the end of each time point, the medium was removed and subjected to the assay kit (Abcam) based on conversion of p-nitrophenyl phosphate to p-nitrophenol.

Calcium content measurement

The inorganic salts were dissolved with normal HCl from the different cultures, and the calcium content was measured using a commercial kit. The dissolved calcium was measured, and its optical density was put against a standard curve optical density.

Alizarin red staining

On day 21 of culture, the medium was removed, and the cells were washed and fixed with formalin 10% for 20 minutes. The formalin was gently removed and washed twice with distilled water. After the formalin fixation, the cultures were incubated in alizarin red dye (40 mM; pH 4.3) at room temperature.²¹ The dye was removed and washed 3 to 4 additional times with distilled water. The stained cultures were imaged using a phase-contrast inverted microscope.

Assessment of matrix mineralization by von Kossa staining

On day 21 of culture, after formalin fixation, the cultures were incubated with 1% silver nitrate and placed under ultraviolet light for 10 minutes and rinsed in distilled water, and unreacted silver was removed with 5% sodium thiosulphate for 5 minutes. After a distilled water rinse, specimens were counterstained with 0.1% nuclear fast red solution for 5 minutes. Finally, samples were dehydrated through graded ethanol, and mounted using DPX mounting medium.²²

Surgical procedure

All dogs were premedicated with an intravenous injection of mixture of atropine sulfate (0.05 mg/kg) and diazepam (1 mg/kg). Anesthesia was induced immediately through intravenous injection of a mixture of ketamine hydrochloride (10 mg/kg) and xylazine (1 mg/kg). The anesthetic depth was maintained with intravenous administration of 2.5% thiopental sodium (Thiopental; EPICO Co). A 10-cm skin incision was made at the proximal third of the medial surface of the tibia. The incision extends through skin and periosteum to expose the bone (Figure 1A). Three 9 mm diameter holes 1 cm apart were created using 9 mm diameter drill. Each defect extended through only one cortex (Figure 1B). The drilled holes were packed using sterile gauze to control hemorrhage from the medullary cavity. The first hole was filled with 1 mL of induced HWJSC suspension (containing 20 × 106 cells, which was counted by hemocytometer with viability determined by trypan blue 0.4%; Sigma). The second hole was packed with coral granules with addition of 1 mL of the previously prepared induced HWJSCs. The third hole was treated with sDCS coral-PLLA. The surgical wound was closed using polyglactin 910 (Vicryl). The operated animals received an antibiotic course of cefotaxime sodium at a dose of 4.5 mg/kg body weight every 8 hours for 5 successive days. The skin sutures were removed 10 days postoperatively.

Postoperative follow-up evaluation

Radiological evaluation

Mediolateral views were taken on a standard 30 × 40-cm film at 45 to 50 kVp, 85 FFD, and 10 mA by using a radiography apparatus (Semens 300). The first radiographs were taken immediately postoperatively and once every 2 weeks until the end of the study (24 weeks). Radiographs were evaluated for the radiographic density of the holes and the new bone formation.

Pathological study

At 4, 12, and 24 weeks, dogs from each group were euthanized and infused with 10% neutral formalin through the aorta. The operated tibiae were harvested and examined grossly. Each defect was inspected for complete or partial filling in relation to the adjacent bone. Bone blocks were taken from the operated tibiae using an electrical surgical saw.
Each sample contained the defect hole with its surrounding healthy tissue. The collected samples were immediately fixed in 10% formalin for 1 week. The samples were decalcified using10% EDTA disodium solution for 1 month.²⁶ Decalcified samples were routinely prepared and impeded in paraffin wax. We mounted 3- to 5-μm sections on glass slides, with slides deparaffinized, rehydrated, and stained with hematoxylin and eosin for histopathological examination.

Statistical analyses

Data were fed to the computer and analyzed using IBM SPSS software package version 20.0 (IBM Corp). The sDCS coral-PLLA nanofiber scaffold group was compared with both coral and MSC groups for cell proliferation, osteogenic differentiation markers (mRNA of ALP, RUNEX, osteonectin), calcium content, and results of ALP assay. Results are presented as range (minimum and maximum), mean and SD, and median using analysis of variance and post hoc tests. Significance of the obtained results was judged at the 5% level.

Results

Electron microscopic scanning of the coral granules and nanomembrane

Coral reef appeared as a 3D porous structure with highly interconnected channel network. It formed from a central large pore (with average size 1 mm × 0.7 mm) and small radiating pores (with average size 230 μm × 200 μm), and the degree of porosity was 45.6% (Figure 2, A-C). Electrospun collagen-PLLA nanofiber scaffold was examined by SEM before seeding of the cells showed randomly distributed fibers with diameters 300 to 320 nm with different sizes of pores and high pore density (Figure 2G).

Isolation and immunophenotypic characterization of human Wharton jelly mesenchymal stem cells

We successfully isolated 18 of 20 samples with viability of 96% to 100%. Adherence to the plastic surface was shown, with fibroblastoid morphology reaching 70% to 80% confluence at day 15 to 21 of culture (Figure 2D). Flow cytometry showed cells to be positive for Oct3/4, CD44, and CD90 and have negative or low expression for CD34 and CD45 (Figure 3).

Results of cell proliferation from different groups

The cell proliferation was assessed on day 7 and day 14 of differentiation. We observed no significant difference between the HWJSC group and the sDCS coral-PLLA nanofiber scaffold group in the different time periods (P = .865 and P = .971); however, the HWJSC plus coral group showed increased cell proliferation versus the sDCS coral-PLLA group on day 7 and day 14 of differentiation (P < .001) (Table 1).

Morphological changes by scanning electron microscope

In the HWJSC group, only 20% to 30% of cells changed into ovoid to rectangular cells on day 21 (Figure 2E). However, morphological changes were shown in 70% to 80% of MSCs on day 14 day in the sDCS coral-PLLA nanofiber scaffold group (Figure 2H) and on day 21 in the coral group (Figure 2F). Cells changed from spindle cells into large oval cells with cell projections. The cells appeared to proliferate rapidly on coral granules and occupy the spaces between the particles. The cells integrated between the nanomembrane fibers and were interconnected by the cellular process.

Quantitative real-time polymerase chain reaction results

We evaluated the gene expression of RUNEX, osteonectin, and ALP at different time points, with expression of these genes increasing at day 21 in the HWJSC group and at day 14 in both the coral group and the nanofiber scaffold group. There was no significant difference between the HWJSC group and the coral group at day 7 (P = .332, .695, and .489, respectively). However, the coral group showed significantly different mRNA level than the HWJSC group at both days 14 and 21 (P < .001). The mRNA level in the nanofiber scaffold group was significantly higher than both the HWJSC group and the coral group at all time points (P < .001) (Figure 4).

Quantitative measurement of alkaline phosphatase

When we measured ALP at different time points, we found no difference between the HWJSC group and the coral group at day 7 (P = .980), with the coral group having significantly higher ALP levels than the HWJSC group at day 14 and day 21 (P < .001). The nanofiber scaffold group showed significantly higher ALP levels than both the HWJSC group and the coral group at all time points (P < .001) (Table 1).

Calcium content assay

The calcium deposition was measured as a late marker of osteogenesis in differentiated HWJSCs using different cultures at different time points. We observed no difference between the HWJSC group and the coral group at day 7 (P = .981), with the coral group having significantly higher calcium content than the HWJSC group at day 14 and day 21 (P < .001). The nanofiber scaffold group showed significantly higher calcium content than both the HWJSC group and the coral group at all time points (P < .001) (Table 1).

Assessment of mineralization by Alizarin red and von Kossa staining

Alizarin red and von Kossa staining were used to indicate the presence of calcified matrix in culture. We observed intense mineralization in the nanofiber scaffold culture group on day 21, with moderate results in thein coral culture group and weak staining in the HWJSC-only culture group (Figure 5).

Sequential radiography

The different groups were evaluated for healing criteria by radiography according to the bone density, new bone formation, and diameter of the hole. Immediately postoperation, the holes packed with coral granules and sDCS coral-nanofiber combination appeared radiopaque, whereas the hole filled with HWJSC suspension appeared radiolucent (Figure 6A). By the end of week 4 postsurgery, the hole implanted with coral-HWJSC granules showed resorption of the implanted materials at its center, which appeared radiolucent, leaving a small radiopaque peripheral zone. The holes implanted with HWJSC remained radiolucent. However, the hole implanted with sDCS coral-nanofiber combi-nation showed slight reduction of the implanted material radiodensity, with disappearance of the demarcation between the implanted materials and the host bone (Figure 6B).

By the end of week 12 postsurgery, no implanted material could be detected at the holes implanted with sDCS coral-nanofiber. Its center appeared radiolucent with a marked radiopaque peripheral zone with marked reduction in its diameter. The holes implanted with HWJSC showed a marked increase in radiodensity at its peripheral zone with marked reduction in its diameter compared with the previous period. Holes implanted with sDCS coral-nanofiber combination appeared homogenously radiodense comparing with the host bone, interspersed with small radiopaque lines. The implanted materials were hardly detected from its surrounds (Figure 6C). At the end of the observation period (24 weeks postsurgery), although the holes implanted with coral granules-HWJSCs and with HWJSCs showed marked reduction in their diameter, they could be easily detected radiographically. The holes implanted with sDCS coral-nanofiber combination completely disappeared, and the implanted area appeared homogenously radiodense comparing with the host bone (Figure 6D).

Pathologically

At 4 weeks postsurgery, the holes implanted with HWJSCs showed formation of trabecular bone (TB) at the margin of the wound and connective tissue (CT) at the center of the wound (Figure 7A). At 12 weeks postsurgery, HWJSC holes showed increasing TB at the wound margin with condensation of the CT at the center (Figure 7B). At 24 weeks postsurgery, formation of compact bone (CB) was shown at the wound margin and condensed CT at the center of the wound (Figure 7C).

The holes filed with corals granules/HWJSCs showed formation of TB at the wound margin, which surrounded a mucous CT. The center of the wound was filled with CT containing blood vessels (Figure 7D). At 12 weeks postsurgery, holes showed increasing TB at the wound margin and condensation of the CT at the center (Figure 7E). At 24 weeks, holes showed formation of immature CB (Figure 7F).

The holes implanted with sDCS coral-nanofiber combination showed formation of TB at the margin of the wound and CT at the center of the wound, which contained numerous blood vessels at week 4 postsurgery (Figure 7G). At week 12 postsurgery, the entire holes were filed with immature CB (Figure 7H). By the end week 24 postsurgery, the entire holes were completely filed with mature CB with Haversian system (Figure 7I).

Discussion

Recent biomaterials that are used in bone tissue regeneration are promising, as they do not have the disadvantages of autografts as bone loss, infection, or morbidity. However, they still lack the ideal properties of autografts, which is the presence of viable cells. In this study, we incorporated HWJSCs with 2 types of scaffolds (coral granules and PLLA nanomembrane) to form organoids assessed and compared their in vitro osteogenic differentiation capacity for the first time according to our knowledge.

Our results confirmed the ability of HWJSCs to adhere and proliferate to both coral granules and PLLA nanofiber scaffold with higher rate of proliferation on coral than HWJSC cultured alone or on nanomembrane.

Selection of an ideal nanofiber polymer is an important factor, with PLLA previously proving its biocompatibility, high porosity, and biodegradability and encouraging the proliferation of HWJSCs.^16,24 In the present study, PLLA nanofibers were made by the electrospinning technique. Modification of the surface properties of the nanofiber is an important issue; thus, in our experiment, it is modified by coating by collagen, which was found to enhance the hydrophilicity, growth, and cell attachment. A recent study by Patel and colleagues found that coating the nanofiber by carbon nanotubes accelerates the adhesion and osteogenic differentiation of HWJSCs.²⁵

Osteogenic differentiation on the different 3D scaffolds was assessed and compared. The mor-phological changes assessed by SEM occurred earlier and were more profound in the nanofiber group than in both the coral granule and HWJSC groups, with cells appearing more in the periphery of the granule grooves and interconnected between the nanofibers. Kooshki and colleagues reported that lipopolysaccharide-treated PLLA nanofiber exhibited more morphological staining by acridine orange stain than those without the nanofiber.16 The ectoenzyme ALP helps the conversion of inorganic phosphate into phosphate, which enters in the mineralization process. In our study, secreted ALP appeared on day 7 in the nanofiber group, before the coral granule group (on day 14) and the HWJSC group (on day 21). Kooshki and colleagues showed increase in the ALP at day 14 using nanofiber plus MSCs.¹⁶

We measured calcium as a late osteogenic assessment. We observed that the nanofiber scaffold group exhibited more mineralization than coral granules or HWJSC alone, which agrees with the previous report by Kooshki and colleagues.¹⁶ In our study, we also assessed the mineralization by Alizarin red and von Kossa staining, which showed earlier and higher stainability in the nanofiber group than the other groups. This may be explained by treatment of nanofiber by collagen to improve the osteogenic differentiation and deposition of the extracellular matrix.

On the molecular level, by real-time RT-PCR, RUNEX, ALP, and osteonectin (which are major osteogenic markers) were investigated at different time points of differentiation. RUNEX is involved in regulation of skeletal gene expression. The secreted ALP is a reflection of osteogene activity. Osteonectin is an extracellular glycoprotein that has a critical role in bone mineralization initiation, cell-matrix interaction, and collagen deposition.²⁶

In the present study, the nanofiber group showed increased mRNA levels of the osteogenetic markers during the period of differentiation, with additionally higher mRNA levels of the osteogenetic markers observed on day 7. However, the markers appeared on day 14 in the coral group and on day 21 in the HWJSC alone group. Kooshki and colleagues and Nie and colleagues also reported that the nanofiber scaffold showed increased expression of the osteogenic genes on day 7.^16,23

From our in vitro results, it appeared that coral granules had a better effect on proliferation of MSCs and the collagen-coated PLLA nanofiber had better osteogenic potential than the coral granules or the HWJSC alone culture. In our in vivo protocol, we thus combined the coral granules and the nanofiber membrane to form double cell sheet as sandwich-shaped 3D scaffold.

Previous studies reported the importance of the cell sheet in bone tissue engineering with the exogenous scaffold as (1) acting as cell carrier, (2) acting as periosteum to prevent the invasion of fibrous tissue before the bone tissue formation inside the scaffold, and (3) promoting osteogenesis in the artificial periosteum and the scaffold.27 To our knowledge, this is the first study to use this sandwich protocol to repair a bone defect.

It is a generally accepted that good bone substi-tutes should resemble as closely as possible to cancellous bone.^28,29 Coral reef has a 3D structure formed from skeleton with a structure like both cortical and cancellous bone.³⁰

The histopathological findings showed increased osteogenesis with new bone formation at the holes implanted with sDCS-PLLA-coral, which was detected at the end of week 12 and became mature by the end of week 24 postsurgery. The hole implanted with HWJSCs was filed with CT throughout the observation period . Only immature bone was shown by the end of week 24 in coral granules–HWJSCs. This may be attributed to the poor osteoinductive nature of the coral reef.⁸ From the histopathological results, we can explain why sDCS-PLLA-coral implanted holes nearly disappeared radiographically by the end of the observation period and why holes implanted with coral granules - HWJSCs and with HWJSCs alone only showed reduction in its diameters. This can be attributed to the newly formed bone in holes implanted with sDCS-PLLA-coral versus CT that filled the holes implanted with coral granules and HWJSCs and HWJSCs alone. The faster bone healing with sDCS-PLLA-coral may be attributable to the conversion of stem cells into osteoblasts and then into osteocytes with subsequent tissue formation and mineralization.³¹ They also have the ability to secrete several growth factors^32,33 along with an ability to reduce the expression level of tumor necrosis factor in the callus.³⁴

When we compared the quality of the newly formed bone, holes implanted with sDCS-PLLA-coral were filled with good quality bone compared with holes implanted with coral-HWJSCs, where remnants of immature bone could be detected and CT in the hole implanted with HWJSCs. This can be explained by the observation by Qin and associates in which the authors stated that direct injection of stem cells alone is inefficient in healing a large bone defect.³⁵ However, the sDCS-PLLA-coral constructed in this study helped to result in more cell proliferation and differentiation with large number of osteoblasts, in addition to the vascular nature of umbilical cord MSCs making the combined complex more conducive to the graft forming an ossified tissue and bone repair. The cell sheet can preserve the intercellular matrix and signals between the cells; the differentiated osteoblasts can also migrate from nanofiber into the coral scaffold and secrete extracellular matrix, making a synergistic effect. The cell sheet acts as cell barrier, prohibiting growth of fibrous tissue into the pores of the scaffold and improving the regeneration in the defect area.³⁶

Conclusions

From in vitro investigations, the coral granules showed better proliferation of HWJSCs than the PLLA nanofiber, and the collagen-coated PLLA nanofiber proved more efficacy in osteogenic induction of HWJSCs than the coral granules. The in vivo experiment of the sDCS-PLLA-coral construct proved successful approach for bone regeneration and repairing the bone gap. This new approach may improve the design of tissue constructs for bone tissue regen-erative therapy.

References:

1. Schmidt-Bleek K, Petersen A, Dienelt A, Schwarz C, Duda GN. Initiation and early control of tissue regeneration - bone healing as a model system for tissue regeneration. Expert Opin Biol Ther. 2014;14(2):247-259. doi:10.1517/14712598.2014.857653
   CrossRef - PubMed
   
2. Stanovici J, Le Nail LR, Brennan MA, et al. Bone regeneration strategies with bone marrow stromal cells in orthopaedic surgery. Curr Res Transl Med. 2016;64(2):83-90. doi:10.1016/j.retram.2016.04.006
   CrossRef - PubMed
   
3. Westhauser F, Hollig M, Reible B, Xiao K, Schmidmaier G, Moghaddam A. Bone formation of human mesenchymal stem cells harvested from reaming debris is stimulated by low-dose bone morphogenetic protein-7 application in vivo. J Orthop. 2016;13(4):404-408. doi:10.1016/j.jor.2016.08.002
   CrossRef - PubMed
   
4. Fernandez de Grado G, Keller L, Idoux-Gillet Y, et al. Bone substitutes: a review of their characteristics, clinical use, and perspectives for large bone defects management. J Tissue Eng. 2018;9:2041731418776819. doi:10.1177/2041731418776819
   CrossRef - PubMed
   
5. Zhao R, Yang R, Cooper PR, Khurshid Z, Shavandi A, Ratnayake J. Bone grafts and substitutes in dentistry: a review of current trends and developments. Molecules. 2021;26(10):3007. doi:10.3390/molecules26103007
   CrossRef - PubMed
   
6. Amini AR, Laurencin CT, Nukavarapu SP. Bone tissue engineering: recent advances and challenges. Crit Rev Biomed Eng. 2012;40(5):363-408. doi:10.1615/critrevbiomedeng.v40.i5.10
   CrossRef - PubMed
   
7. Sohn HS, Oh JK. Review of bone graft and bone substitutes with an emphasis on fracture surgeries. Biomater Res. 2019;23:9. doi:10.1186/s40824-019-0157-y
   CrossRef - PubMed
   
8. Emara SA, Gadallah SM, Sharshar AM. Histological studies on the use of bovine bone chips and composite as bone graft substitutes in reconstruction of gap defects in canine tibia. J Am Sci. 2013;9 (7):514-525.
   CrossRef - PubMed
   
9. Emara SA, Gadallah SM, Sharshar AM. Evaluation of coral wedge and composite as bone graft substitutes to induce new bone formation in a dog tibial defect. J Am Sci. 2013;9(7):526-537.
   CrossRef - PubMed
   
10. Yamada M, Egusa H. Current bone substitutes for implant dentistry. J Prosthodont Res. 2018;62(2):152-161. doi:10.1016/j.jpor.2017.08.010
    CrossRef - PubMed
    
11. Wu Z, Liang J, Huang W, et al. Immunomodulatory effects of mesenchymal stem cells for the treatment of cardiac allograft rejection. Exp Biol Med (Maywood). 2021;246(7):851-860. doi:10.1177/1535370220978650.
    CrossRef - PubMed
    
12. Diaz-Rodriguez P, Lopez-Alvarez M, Serra J, Gonzalez P, Landin M. Current stage of marine ceramic grafts for 3D bone tissue regeneration. Mar Drugs. 2019;17(8):471. doi:10.3390/md17080471
    CrossRef - PubMed
    
13. Day AGE, Francis WR, Fu K, Pieper IL, Guy O, Xia Z. Osteogenic potential of human umbilical cord mesenchymal stem cells on coralline hydroxyapatite/calcium carbonate microparticles. Stem Cells Int. 2018;2018:4258613. doi:10.1155/2018/4258613
    CrossRef - PubMed
    
14. Decambron A, Fournet A, Bensidhoum M, et al. Low-dose BMP-2 and MSC dual delivery onto coral scaffold for critical-size bone defect regeneration in sheep. J Orthop Res. 2017;35(12):2637-2645. doi:10.1002/jor.23577
    CrossRef - PubMed
15. Li D, Zhang K, Shi C, et al. Small molecules modified biomimetic gelatin/hydroxyapatite nanofibers constructing an ideal osteogenic microenvironment with significantly enhanced cranial bone formation. Int J Nanomedicine. 2018;13:7167-7181. doi:10.2147/IJN.S174553
    CrossRef - PubMed
    
16. Kooshki H, Ghollasi M, Halabian R, Kazemi NM. Osteogenic differentiation of preconditioned bone marrow mesenchymal stem cells with lipopolysaccharide on modified poly-l-lactic-acid nanofibers. J Cell Physiol. 2019;234(5):5343-5353. doi:10.1002/jcp.26567
    CrossRef - PubMed
    
17. Lian M, Sun B, Qiao Z, et al. Bi-layered electrospun nanofibrous membrane with osteogenic and antibacterial properties for guided bone regeneration. Colloids Surf B Biointerfaces. 2019;176:219-229. doi:10.1016/j.colsurfb.2018.12.071
    CrossRef - PubMed
    
18. Kang SH, Kim MY, Eom YW, Baik SK. Mesenchymal stem cells for the treatment of liver disease: present and perspectives. Gut Liver. 2020;14(3):306-315. doi:10.5009/gnl18412
    CrossRef - PubMed
    
19. Sheehy EJ, Lemoine M, Clarke D, Gonzalez Vazquez A, O’Brien FJ. The incorporation of marine coral microparticles into collagen-based scaffolds promotes osteogenesis of human mesenchymal stromal cells via calcium ion signalling. Mar Drugs. 2020;18(2):74. doi:10.3390/md18020074
    CrossRef - PubMed
    
20. Pu L, Meng M, Wu J, et al. Compared to the amniotic membrane, Wharton’s jelly may be a more suitable source of mesenchymal stem cells for cardiovascular tissue engineering and clinical regeneration. Stem Cell Res Ther. 2017;8(1):72. doi:10.1186/s13287-017-0501-x
    CrossRef - PubMed
    
21. Wei X, Hu YJ, Xie WP, Lin RL, Chen GQ. Influence of poly(3-hydroxybutyrate-co-4-hydroxybutyrate-co-3-hydroxyhexanoate) on growth and osteogenic differentiation of human bone marrow-derived mesenchymal stem cells. J Biomed Mater Res A. 2009;90(3):894-905. doi:10.1002/jbm.a.32146
    CrossRef - PubMed
22. Salih MM. Comparison between conventional decalcification and a microwave-assisted method in bone tissue affected with mycetoma. Biochem Res Int. 2020;2020:6561980. doi:10.1155/2020/6561980
    CrossRef - PubMed
    
23. Nie W, Gao Y, McCoul DJ, et al. Rapid mineralization of hierarchical poly(l-lactic acid)/poly(epsilon-caprolactone) nanofibrous scaffolds by electrodeposition for bone regeneration. Int J Nanomedicine. 2019;14:3929-3941. doi:10.2147/IJN.S205194
    CrossRef - PubMed
    
24. Martelli G, Bloise N, Merlettini A, et al. Combining biologically active beta-lactams integrin agonists with poly(l-lactic acid) nanofibers: enhancement of human mesenchymal stem cell adhesion. Biomacromolecules. 2020;21(3):1157-1170. doi:10.1021/acs.biomac.9b01550
    CrossRef - PubMed
    
25. Patel KD, Kim TH, Mandakhbayar N, et al. Coating biopolymer nanofibers with carbon nanotubes accelerates tissue healing and bone regeneration through orchestrated cell- and tissue-regulatory responses. Acta Biomater. 2020;108:97-110. doi:10.1016/j.actbio.2020.03.012
    CrossRef - PubMed
    
26. Dole NS, Kapinas K, Kessler CB, et al. A single nucleotide polymorphism in osteonectin 3' untranslated region regulates bone volume and is targeted by miR-433. J Bone Miner Res. 2015;30(4):723-732. doi:10.1002/jbmr.2378
    CrossRef - PubMed
    
27. Syed-Picard FN, Shah GA, Costello BJ, Sfeir C. Regeneration of periosteum by human bone marrow stromal cell sheets. J Oral Maxillofac Surg. 2014;72(6):1078-1083. doi:10.1016/j.joms.2014.02.005
    CrossRef - PubMed
    
28. Haugen HJ, Lyngstadaas SP, Rossi F, Perale G. Bone grafts: which is the ideal biomaterial? J Clin Periodontol. 2019;46 Suppl 21:92-102. doi:10.1111/jcpe.13058
    CrossRef - PubMed
    
29. Zakrzewski W, Dobrzynski M, Rybak Z, Szymonowicz M, Wiglusz RJ. Selected nanomaterials' application enhanced with the use of stem cells in acceleration of alveolar bone regeneration during augmentation process. Nanomaterials (Basel). 2020;10(6):1216. doi:10.3390/nano10061216
    CrossRef - PubMed
    
30. Clarke SA, Walsh P, Maggs CA, Buchanan F. Designs from the deep: marine organisms for bone tissue engineering. Biotechnol Adv. 2011;29(6):610-617. doi:10.1016/j.biotechadv.2011.04.003
    CrossRef - PubMed
    
31. Doi K, Abe Y, Kobatake R, et al. Novel development of phosphate treated porous hydroxyapatite. Materials (Basel). 2017;10(12):1405. doi:10.3390/ma10121405
    CrossRef - PubMed
    
32. Do AD, Kurniawati I, Hsieh CL, Wong TT, Lin YL, Sung SY. Application of mesenchymal stem cells in targeted delivery to the brain: potential and challenges of the extracellular vesicle-based approach for brain tumor treatment. Int J Mol Sci. 2021;22(20):11187. doi:10.3390/ijms222011187
    CrossRef - PubMed
    
33. Chang X, Ma Z, Zhu G, Lu Y, Yang J. New perspective into mesenchymal stem cells: Molecular mechanisms regulating osteosarcoma. J Bone Oncol. 2021;29:100372. doi:10.1016/j.jbo.2021.100372
    CrossRef - PubMed
    
34. Liu H, Li D, Zhang Y, Li M. Inflammation, mesenchymal stem cells and bone regeneration. Histochem Cell Biol. 2018;149(4):393-404. doi:10.1007/s00418-018-1643-3
    CrossRef - PubMed
    
35. Qin X, Raj RM, Liao XF, et al. Using rigidly fixed autogenous tooth graft to repair bone defect: an animal model. Dent Traumatol. 2014;30(5):380-384. doi:10.1111/edt.12101
    CrossRef - PubMed
    
36. Zhang H, Zhou Y, Yu N, et al. Construction of vascularized tissue-engineered bone with polylysine-modified coral hydroxyapatite and a double cell-sheet complex to repair a large radius bone defect in rabbits. Acta Biomater. 2019;91:82-98. doi:10.1016/j.actbio.2019.04.024
    CrossRef - PubMed