Objectives: Human cytomegalovirus (HCMV) is a common cause of infection worldwide. Severe cytomegalovirus disease is usually observed in immunodeficient individuals such as bone marrow transplant (BMT) or AIDS patients. In these patients, proof of viral presence is not enough for making clinical decisions; one must report the quantity of virus or viral load in appropriate clinical specimens to demonstrate the relationship between disease severity and HCMV infection. The goal of this study was to use quantitative competitive polymerase chain reaction (PCR) to determine HCMV viral load in 26 BMT recipients.

Materials and Methods: Peripheral blood was collected weekly for 100 days from 26 BMT recipients. Qualitative and quantitative competitive PCRs on 10⁵ mononuclear cells were performed for each patient. The same tests were performed once for each of 26 donors. In addition, the anti-HCMV humoral response was detected by performing IgM and IgG ELISAs in donors and recipients prior to transplantation.

Results: Of 26 BMT donors and recipients, 25 and 26 were IgG positive, and 2 and 6 had HCMV-specific IgM antibodies, respectively. From 313 total clinical specimens tested, 255 had positive qualitative PCR results. Results of quantitative PCR on the same specimens demonstrated that in 14 patients, viral copy number per 10⁵ cells had increased, pointing toward HCMV reactivation. In others, changes in viral copy number were mostly around 100/10⁵ cells, with an upper limit of 300/10⁵ cells.

Conclusions: Owing to the high prevalence of cytomegalovirus in our country, the chance of viral reactivation and HCMV infection/disease upon transplantation must be seriously considered. Therefore, use of quantitative PCR in PCR-positive patients is highly recommended to demonstrate active infection that may lead to HCMV disease during the posttransplant period. This also could help physicians begin pre-emptive therapy that would be for a shorter treatment period and provide for better outcomes in infected BMT patients.

Key words : Human cytomegalovirus, Bone marrow transplantation, Quantitative PCR, Viral load

Human cytomegalovirus (HCMV) infection is the most common and potentially devastating opportunistic viral infection in bone marrow transplant (BMT) recipients, causing severe complications such as interstitial pneumonia, gastrointestinal disorders, and marrow suppression. Antiviral agents such as ganciclovir have clinical benefits, either preventing or curing HCMV disease after BMT [1-3]; however, because they are associated with toxicity and great expense, they must be used to treat only those patients with a high risk of HCMV disease. Thus, rapid and sensitive tests to diagnose HCMV infection are needed to predict or detect infection in the early stages of the disease before clinically significant symptoms occur. Serologic tests to detect specific anti-HCMV antibodies are not reliable markers of HCMV infection in BMT patients because of defective humoral responses and passively transferred antibodies [4-6]. In addition, viral cultures have weak sensitivity for showing HCMV disease during BMT.

Various techniques have been developed to address this limitation, including both nonmolecular and molecular tests. Because of its sensitivity, qualitative polymerase chain reaction (PCR) was the first method used, but this method cannot differentiate between infection and disease in transplant recipients. In contrast, quantitative PCR methods have shown that immune-suppressed patients with high viral loads are at great risk of developing HCMV disease [7-9].

The aim of this study, using previously developed qualitative and quantitative competitive PCR methods, was to detect and quantify HCMV genome load in peripheral blood mononuclear cells (PBMCs) of BMT recipients.

Materials and Methods

Twenty-six patients (17 males, 9 females; age range, 5-42 years; mean, 15.9 years) were admitted for BMT between April 2003 and September 2004 at the BMT Center of Namazi General Hospital in Shiraz, Iran. Three hundred thirteen blood samples were collected weekly from BMT patients as long as they were available. PBMCs from the patients were tested for HCMV by qualitative and quantitative PCR between 7 days before transplantation and 100 days after transplantation. One sample from each donor also was tested using qualitative and quantitative PCR (26 samples). Informed consent was obtained from all patients or their guardians.

Recipients did not receive ganciclovir prophylaxis. Patients with a high index of clinical suspicion of HCMV disease received ganciclovir only at the discretion of the clinicians. However, all patients received prophylactic acyclovir from the first week until at least 100 days after surgery.

Pretransplant HCMV IgG and IgM were tested in plasma samples of donors and recipients using qualitative ELISA kits (Dia.Pro Diagnostic Bioprobes, Milano, Italy) according to the manufacturer’s instructions. Ten milliliters of whole blood was collected in a tube with ethylenediaminetetraacetic acid and processed within 4 hours after drawing. PBMCs were isolated using Ficoll-Hypaque density centrifugation at 1200 g for 30 minutes. Cells were then washed with phosphate-buffered saline (PBS) (pH, 7.4) and counted with a hematologic cell counter. PBMCs were adjusted with PBS to 106 cells/100 µL and frozen at -70°C until extraction. Plasma was harvested, aliquotted, and kept at -70°C.

DNA was extracted from 100 µL of cell suspension (10⁶ cells) by digestion with 100 µg/mL protease K at 55°C for 1 hour. After boiling for 10 minutes, DNA was extracted with one volume of phenol-chloroform-isoamylalcohol (25:24:1) and precipitated with 0.1 volume of sodium acetate (pH, 7.2) and 2 volumes of absolute ethanol. After centrifugation at 13 000 g for 30 minutes (Eppendorf centrifuge model number 5415R, Germany), the pellets were washed with 70% ethanol and resuspended in 50 µL of H₂O. A 5-µL sample was subjected to both qualitative and quantitative PCRs. Positive and negative controls for HCMV DNA were always included during the extraction procedure.

A modified qualitative PCR was performed [10]. For amplification, one set of primers (22 base primers, an upstream primer, 82494-82515 nucleotide position: 5´-3´ CGGTGGAGATACTGCTGAGGTC, and a down stream primer, 82729-82750 nucleotide position: 5´-3´ CAAGGTGCTGCGTGATATGAAG); full HCMV genome sequence (gene bank accession number: NC-001347) was used to generate the HCMV 257bp fragment, located within gB (glycoprotein B) (gene bank accession number: DQ089700). The 257 bp amplicons were generated using a Pfu enzyme in blunt-end form, purified, and then cloned into a PTZ57R plasmid. Amplification was carried out in 50 µL final volume containing 5 µL of extracted DNA, 1.5 U of Taq DNA polymerase (Roche Diagnostics GmbH, Mannheim, Germany), 25 pmol of each primer, 10 mM tris-HCl, 50 mM KCl, 2 mM MgCl2, and 0.2 mM dNTP sets. PCR cycle parameters involved an initial incubation at 94°C, followed by 42 cycles at 94°C for 45 seconds, 60°C for 1 minute, and 72°C for 1 minute, with a final extension step of 10 minutes at 72°C (Eppendrof Mastercycler Gradient, Germany). The amplified DNA was separated by agarose gel electrophoresis. The gel was stained with ethidium bromide (2 µg/mL) for 10 minutes, washed, and photographed under UV illumination.

Quantitative PCR was done for specimens with positive qualitative PCR results. Target sequences were quantitated by competitive PCR with cloned internal standard (IS) sequences, which were produced by amplification of a 156 bp region of the lambda genome. To achieve this, an HCMV primer binding site was added to the 5' end of lambda-specific primers. The result was a 200-bp IS sequence fragment (Table 1). Quantitative PCR was done by adding 1000 copies of IS to the PCR master mix, and the PCR cycle number was reduced to 38 instead of 42. Annealing temperature also was reduced from 60°C to 55°C. In each run, one series of competitive controls was tested; serial cloned gB DNA fragments were coamplified with 1000 IS copies. The 2 amplicons were separated by gel electrophoresis and UV visualized after ethidium bromide staining. Bands were quantified by Sion Image photo densitometry software (Version Beta 4.0.2, Sion Corporation, USA) to generate a standard curve by plotting the log ratio of gB/IS amplicons against the log of the gB copy number added to each PCR. The curve was used to interpolate the amount of HCMV DNA in clinical samples from their wild-type/competitor PCR product ratio.

A Pearson analysis was used to compare the correlation between IgM seropositivity, age, sex, and underlying disease with HCMV reactivation, and also ganciclovir therapy with a reduction in HCMV copy number (as a qualitative variable). A P value less than .05 was considered significant.

Results

Before transplantation, all 26 patients (100%) had anti- HCMV IgG, and 6 patients (20.3%) had anti-HCMV IgM antibodies. In donors, 25 (96%) had IgG, and 2 (7.7%) had anti-HCMV IgM (Table 2) antibodies respectively. After serial dilutions and preparation of the plasmid containing the HCMV 257 bp fragment, qualitative PCR was able to detect about 10 copies of the recombinant DNA. Quantitative PCR involving coamplification of 1000 IS copies could detect 10 to 10⁵ plasmid copies. After coamplification of the clinical samples with 1000 IS copies, copies of less than 100 usually were not clearly visible on the gel. Therefore, samples positive in qualitative PCR but without a clear band in quantitative PCR were classified as having a viral copy number ≤ 100.

All patients were followed for 16 weeks, except for those traveling back to their hometown or those who passed away prior to the complete sample collection at 16 weeks. In total, there were 313 samples from 26 transplant recipients, of which 225 samples were positive for HCMV DNA. A majority of donor samples (18) also tested positive for HCMV DNA (copy number range: ≤ 100-150).

No significant relationship existed between age (P = .836), sex (P = .175), and the degree of reactivation of the virus. The relationship between the presence of IgM in donors (P = .492) or recipients (P = .914) and viral reactivation was not significant, as was the relationship between background disease and viral reactivation (P > .05).

HCMV-related symptoms were observed in 14 patients, and HCMV reactivation/infection was detected in 1 patient who did not develop HCMV disease. In patients with HCMV-related symptoms, on average, an increase in HCMV copy number was seen from the third week after transplantation, with the maximum copy number observed during the seventh week (Table 2). Ganciclovir treatment was started after an observation of HCMV clinical symptoms in the seventh week after transplantation, on average. In patients with fewer than 4300 viruses/10⁵ cells, ganciclovir treatment reduced the copy number beginning at the first week of administration; however, in patients with copy numbers higher than 7000, it took 2 weeks to have an effect. In all cases, ganciclovir administration clearly was able to decrease the virus copy number but not to levels undetectable in PCR (Table 2).

Discussion

HCMV is one of the most important opportunistic infections in immunosuppressed patients, especially in organ transplant recipients [11-13]. Infection with HCMV leads to problems such as HCMV disease or graft rejection or a suppressed immune system, allowing other bacterial or fungal infections to invade the host [4].

Rapid diagnosis of active HCMV infection is important for beginning treatment, infection control, and reducing the progression and severity of the disease [9,14,15]. PCR and an antigenemia assay are common methods for detecting HCMV infection [16, 17]. Quantitative PCR can measure changes in virus copy number and has a higher positive predictive value than does qualitative PCR in different patient populations suspected of having HCMV disease. It is a more appropriate test than antigenemia in BMT patients owing to the low white blood cell counts in this population. This is especially true in societies with a high prevalence of HCMV infection [18-21]. Monitoring patients and treatment decisions are much easier for D-/R- or D+/R- patients rather than D+/R+ or D-/R+ because the latter group requires more than a positive PCR test result to start treatment (D = donor, R = recipient, + = seropositive, - = seronegative) [4]. All of the recipients, and all but 1 of the donors had been infected previously with cytomegalovirus (Table 2). Under these circumstances, such BMT recipients should be considered at a high risk of latent HCMV reactivation and followed for posttransplant HCMV infection/disease.

In this study, HCMV disease was diagnosed by clinical symptoms and virologic confirmation of HCMV infection (nested PCR on plasma, data not shown). The average age of the transplant recipients was 12 years old because most recipients were thalassemic children. Of the 14 patients that showed symptoms of involvement with HCMV, 8 (57%) had gastroenteritis, and 4 had additional symptoms such as hepatitis and renal involvement. Renal involvement with fever, with or without hemorrhagic cystitis, occurred in 3 patients, and pneumonia occurred in 3 others.

In the population studied, antiviral treatment with ganciclovir was started only after clinical symptoms of HCMV disease appeared; in most patients, when the virus had its maximum copy number in 10⁵ cells (Table 2). To prevent the disease and limit its problematic consequences more effectively, it is recommended that anti-HCMV treatment be given prophylactically to patients demonstrating an increasing trend in their viral load. The promising fact in the treatment of these patients is that after ganciclovir administration, viral copy number decreased, even though it did not reach undetectable levels in PBMCs. This can be explained by the fact that these cells are the main site of HCMV latency.

Comparing the quantitative PCR results from patients affected by HCMV, with those that were not affected by HCMV, as well as those of donors, it seems that 300 virus copies in 10⁵ cells could be considered as the cut-off value in our test.

The results of the current study demonstrate that there is a 2- to 4-week gap between HCMV reactivation/infection commencement and manifestation of HCMV disease. This interval lets the physician use current molecular viral diagnostic techniques to make accurate decisions on treatment. At our center, using quantitative competitive PCR seems to be helpful in deciding whether or not to treat with ganciclovir by estimating the virus copy number in BMT recipients.

References:

1. de Jong MD, Galasso GJ, Gazzard B, Griffiths PD, Jabs DA, Kern ER, Spector SA. Summary of the II International Symposium on Cytomegalovirus. Antiviral Res 1998; 39: 141-162
2. Reddy V, Hao Y, Lipton J, Meharchand J, Minden M, Mazzulli T, et al. Management of allogeneic bone marrow transplant recipients at risk for cytomegalovirus disease using a surveillance bronchoscopy and prolonged pre-emptive ganciclovir therapy. J Clin Virol 1999; 13: 149-159
3. Meijer E, Boland GJ, Verdonck LF. Prevention of cytomegalovirus disease in recipients of allogeneic stem cell transplants. Clin Microbiol Rev 2003; 16: 647-657
4. Kamar N, Mengelle C, Yahyaoui S, Sandres-Saune K, Durand D, Izopet J, Rostaing L. Follow-up of 28 HCMV seropositive renal-transplant recipients: comparison of clinical, biological and virological parameters in the groups of treated versus untreated infected patients. J Clin Virol 2005; 33: 35-42
5. Caliendo AM, St George K, Allega J, Bullotta AC, Gilbane L, Rinaldo CR. Distinguishing cytomegalovirus (CMV) infection and disease with CMV nucleic acid assays. J Clin Microbiol 2002; 40: 1581-1586
6. Sweet C. The pathogenictiy of cytomegalovirus. FEMS Microbiol Rev 1999; 23: 457-482
7. Preiser W, Brauninger S, Schwerdtfeger R, Ayliffe U, Garson JA, Brink NS, et al. Evaluation of diagnostic methods for the detection of cytomegalovirus in recipients of allogeneic stem cell transplants. J Clin Virol 2001; 20: 59-70
8. Grundy JE, Ehrnst A, Einsele H, Emery VC, Hebart H, Prentice HG, Ljungman P. A three-center European external quality control study of PCR for detection of cytomegalovirus DNA in blood. J Clin Microbiol 1996; 34: 1166-1170
9. Nolte FS, Emmens RK, Thurmond C, Mitchell PS, Pascuzzi C, Devine SM, et al. Early detection of human cytomegalovirus viremia in bone marrow transplant recipients by DNA amplification. J Clin Microbiol 1995; 33: 1263-1266
10. Ziyaeyan M, Sabahi F, Alborzi A, Mahboudi F, Karimi M, Ramzi M, et al. Development of a sensitive quantitative competitive PCR assay for detection of human cytomegalovirus DNA Iran Biomed J 2005; 9: 187-191
11. Emery VC, Cope AV, Sabin CA, Burroughs AK, Rolles K, Lazzarotto T, et al. Relationship between IgM antibody to human cytomegalovirus, virus load, donor and recipient serostatus, and administration of methylprednisolone as risk factors for cytomegalovirus disease after liver transplantation. J Infect Dis 2000; 182: 1610-1615
12. Moray G, Koseoglu F, Karakayali H, Demirag A, Bilgin N, Haberal M. Cytomegalovirus infection in kidney transplant recipients at our center. Transplant Proc 1999; 31: 3205-3206
13. Lassner D, Geissler F, Bosse S, Hofmann J, Witzigmann H, Remke H, et al. Diagnosis and monitoring of acute cytomegalovirus infection in peripheral blood of transplant recipients by nested reverse transcriptase polymerase chain reaction (RT-PCR). Transplant Int 2000; 13 Suppl 1: S366-S371
14. Einsele H, Ehninger G, Hebart H, Wittkowski KM, Schuler U, Jahn G, et al. Polymerase chain reaction monitoring reduces the incidence of cytomegalovirus disease and the duration and side effects of antiviral therapy after bone marrow transplantation. Blood 1995; 86: 2815-2820
15. Yuen KY, Lo SK, Chiu EK, Wong SS, Lau YL, Liang R, et al. Monitoring of leukocyte cytomegalovirus DNA in bone marrow transplant recipients by nested PCR. J Clin Microbiol 1995; 33: 2530-2534
16. Aono T, Kondo K, Miyoshi H, Tanaka-Taya K, Kondo M, Osugi Y, et al. Monitoring of human cytomegalovirus infections in pediatric bone marrow transplant recipients by nucleic acid sequence-based amplification. J Infect Dis 1998; 178: 1244-1249
17. Gozlan J, Laporte JP, Lesage S, Labopin M, Najman A, Gorin NC, Petit JC. Monitoring of cytomegalovirus infection and disease in bone marrow recipients by reverse transcription-PCR and comparison with PCR and blood and urine cultures. J Clin Microbiol 1996; 34: 2085-2088
18. Barber L, Egan JJ, Lomax J, Haider Y, Yonan N, Woodcock AA, et al. A prospective study of a quantitative PCR ELISA assay for the diagnosis of CMV pneumonia in lung and heart-transplant recipients. J Heart Lung Transplant 2000; 19: 771-780
19. Satou J, Funato T, Satoh N, Abe Y, Ishii KK, Sasaki T, Kaku M. Quantitative PCR determination of human cytomegalovirus in blood cells. J Clin Lab Anal 2001; 15: 122-126
20. Weinberg A, Schissel D, Giller R. Molecular methods for cytomegalovirus surveillance in bone marrow transplant recipients. J Clin Microbiol 2002; 40: 4203-4206
21. Yan SS, Fedorko DP. Recent advances in laboratory diagnosis of human cytomegalovirus infection. Clinical and Applied Immunology Reviews 2002; 2: 155-167